1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivahew [28]
2 years ago
9

An example of a community​

Biology
1 answer:
Lelechka [254]2 years ago
6 0

Answer:

Community, also called biological community, in biology, an interacting group of various species in a common location. For example, a forest of trees and undergrowth plants, inhabited by animals and rooted in soil containing bacteria and fungi, constitutes a biological community.

Explanation:

You might be interested in
With a suitable diagram explain reflex action and reflex arc
vampirchik [111]
Reflex action in the diagram would be the response. Diagram extracted from online.

5 0
3 years ago
Scientists and doctors are working hard to find a way to cure cancer. Which cellular process are they studying to try and cure t
Natasha_Volkova [10]

Answer:

<em>The correct option is B) regulation of mitosis</em>

Explanation:

Cancer can be described as a group of diseases which result from uncontrolled, abnormal cell division. The cell division by which the cells divide (except sex cells) is termed as mitosis. Hence, scientists will be studying the regulation of mitosis if they are to find a cure for cancer.

Other options like option A are not correct because only sex cells divide by meiosis. Hence, regulation of meiosis will not cure cancer.

5 0
3 years ago
A _____________ is a rootlike structure of nonvascular plants that is usually one cell thick.
o-na [289]

Answer:

rhizoid

Explanation:

Mark brainliest

have a great day!

5 0
3 years ago
Will give brainliest! Please give the correct awnser.
Lyrx [107]

The answer is C. Population size

7 0
2 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Consumers engage in limited search for items like midrange fashion apparel, home furnishings, and appliances. These are examples
    12·1 answer
  • What is the relationship between earth’s surface and living organisms?
    12·1 answer
  • Zachary is a 17-year-old male who appears boastful, conceited, and arrogant. when someone accuses him of being that way, he flie
    7·1 answer
  • Lev Vygotsky believed that learning takes place on two levels. According to him, how do all higher intellectual functions begin?
    12·1 answer
  • Ling is devising a checklist to predict a female child's reaching puberty early. which is not a question he should include in hi
    11·1 answer
  • List nine major types of water pollutants and give an example of each apes
    5·1 answer
  • A collection of ideas and beliefs that sound like science but not supported by evidence, such as bigfoot, is known as...
    13·1 answer
  • Which bases are always opposite of one another or bonded in DNA
    11·1 answer
  • The polysaccharide that is responsible for the strong structural nature of plant cell walls is
    9·1 answer
  • Why are antibodies from White Blood Cells so important when getting a blood transfusion?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!