1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tom [10]
3 years ago
15

What is the biggest obstacle to traveling by boat on the Congo River?

Geography
2 answers:
Rufina [12.5K]3 years ago
8 0
D. The river’s narrow width
xxMikexx [17]3 years ago
3 0
Your answer would be (D) :)
You might be interested in
In 2002, Colorado was suffering from extreme drought. Which technology will help Colorado reduce the effects of future droughts?
Blababa [14]
I think the correct answer would be B
7 0
3 years ago
Read 2 more answers
How has population growth affected the Sub-Saharan Africa region?
Hoochie [10]

Answer:

The population of sub-Sahara Africa has grown from 186 million to 856 million people from 1950-2010. That’s about 11 million people a year for the past 60 years or approximately 670 million people in 60 years. By 2060, the population of sub-Sahara Africa could be as large as 2.7 billion people.

4 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
8. Which of the following religions is
alexandr1967 [171]
It’s D (Christianity)
5 0
2 years ago
PLEASE ANSWER QUICK
KonstantinChe [14]

Answer:

your mom gay lolololololol

Explanation:

5 0
3 years ago
Other questions:
  • Which body of water joins the southeastern pacific and the southwestern atlantic oceans?
    15·2 answers
  • The active sections that are located along fault lines are called
    14·1 answer
  • Greenland is a province of which Nordic country?
    8·1 answer
  • The northern lights is a beautiful phenomenon that takes place in the troposphere.
    11·1 answer
  • Where does the Venus flytrap get its nutrients
    12·2 answers
  • Above-ground pipelines save permafrost from destruction but they can
    15·1 answer
  • Which force of change to Earth is caused by the movement of tectonic plates?
    9·2 answers
  • What are some examples of European influence on the history and culture of Mexico, Central America, and the Caribbean?
    5·1 answer
  • Early that morning, a tissue sample from a cow in Washington State had tested positive for bovine spongiform encephalopathy (BSE
    15·1 answer
  • 1. How did Japan's shogunate enforce its military rule?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!