Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The disappearance of the deer from the forest indicates the EXTINCTION OF THE DEER.
The extinction of the deer from the forest will throw the ecosystem out of balance and has negative impacts on the ecosystem. After all the deer has been eliminated, the elephants too will either have to find another source of food or be wiped out.
Water boils at 100<span>°C</span>
1,000 years
In many parts of the world, trees can provide a climate history for hundreds of years, with some extending back 1,000 years or more.
Homeostasis refers to the body's ability to maintain certain things with
the body at the same level, this is demonstrated for example in
warm-blooded animals having a constant temperature.
