1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
abruzzese [7]
3 years ago
9

Describe the difference between genetic drift and gene flow.

Biology
2 answers:
jasenka [17]3 years ago
8 0
Gene flow is the process of alleles going from one population to another while GENETIC DRFT is the alteration of allele frequency in a gene pool
Ray Of Light [21]3 years ago
6 0

Answer:

Gene flow is the process of alleles going from one population to another while genetic drift is the alteration of allele frequency in a gene pool. The cause of gene flow is migration or geographical isolation while that of genetic drift is random sampling with two mechanisms

Explanation:

You might be interested in
What affect do algae blooms have on ocean ecosystems?(1 point) increased underwater plant population decreased carbon dioxide in
Umnica [9.8K]
An algal bloom affects the whole ecosystem. Consequences range from the benign feeding of higher trophic levels, to more harmful effects like blocking sunlight from reaching other organisms, causing a depletion of oxygen levels in the water, and, depending on the organism, secreting toxins into the water.
6 0
3 years ago
An age-related change in the nervous system that can adversely affect nutritional status is
Nookie1986 [14]
An age-related change in the nervous system that can adversely affect nutritional status is decreased taste perception, hearing loss and vision loss. Aging refers to a multidimensional process in humans, the process of physical, and psychological, and social changes. As a population, older adults are more prone to age-related diseases, functional impairment, and physical inability that nay interfere with the maintenance of a good nutritional status. 
4 0
4 years ago
In each of the scenarios, an individual heterozygous for the indicated gene or genes is crossed with an identical heterozygous i
Leno4ka [110]
Oi como você está? Decênio 1:
3 0
4 years ago
How is a tendon different from a ligament? A. A tendon joins a bone to a bone; a ligament joins a muscle to a bone. B. A tendon
rusak2 [61]
B is correct. A tendon will join a muscle to a bone, and a ligament joins a bone to another bone. I think of it this way, partly influenced by my biology teacher:

- The achilles tendon, at the back of your foot, clearly joins foot to calf muscle
- The word ligament comes from 'deligare' in Latin, which roughly means to tie           together. A ligament 'ties' two bones together

I hope this helps
6 0
3 years ago
Read 2 more answers
BRAINLIST
solniwko [45]

Answer:

Unfortunately, you can rarely identify a mineral only by its color. Sometimes, different minerals are the same color. For example, you might find a mineral that is a gold color, and so think it is gold. But it might actually be pyrite, or “fool's gold,” which is made of iron and sulfide.

Explanation:

4 0
3 years ago
Other questions:
  • Which structure of protein is amino acid sequence. D is quaternary
    8·2 answers
  • Which type of protein in the plasma membrane has carbohydrate attached to it so that cells can be distinguished from one another
    5·1 answer
  • Compare the exertory functions of the kidneys and the lungs
    10·1 answer
  • Close observation of the fruiting bodies of cup fungi (ascomycetes) shows that when asci of cup fungi forcibly eject their spore
    11·2 answers
  • Which type of cell is pictured on the right?​
    5·2 answers
  • Explain the connection between the Nucleolus, ribosome, and RER.
    13·1 answer
  • A student notices that when bananas are kept near other fruits, the other fruits ripen faster. She wonders what causes the other
    9·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • How is cellular respiration related to metabolism?.
    14·1 answer
  • Which statement best describes a pattern of reproduction exhibited by most aquatic vertebrates
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!