1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ladessa [460]
3 years ago
7

Where does an ecosystem’s energy originally come from ?

Biology
1 answer:
lions [1.4K]3 years ago
5 0

Answer:

from the sun

Explanation: Energy enters the ecosystem from the Sunand exits after the organisms have taken as much as they need. Organisms release energy back into the biosphereas heat. Energy also enters the ecosystem from the interior of the Earth. It is usually in the form of heat, not the electromagnetic radiation from the Sun.

You might be interested in
Flexor muscles are named based on which aspect of the muscles?
ladessa [460]

Answer:

Some muscles are named based on their size and location, such as the gluteal muscles of the buttocks. Other muscle names can indicate the location in the body or bones with which the muscle is associated, such as the tibialis anterior.

i believe its size

Explanation:

3 0
3 years ago
Explain how body symmetry is related to the phylogeny of animals.
Blizzard [7]

Do not worry so much about the why of classification. Classification is important because it is a lens through which to see what is there. It is not intrinsically true in and of itself. Distinctions are important only as vehicles for a common base of communication. All things have symmetry. A reflection has symmetry. Symmetry means organized life. Organized life is what happens when RNA replicates. It is the difference between chaos and order

4 0
3 years ago
Describe two characteristics of Earth’s crust.
Alex Ar [27]

Answer:

the core / rocks

Explanation:

4 0
3 years ago
Read 2 more answers
If acetyl-CoA is labeled with 14C at its methyl group, how many rounds of the cycle are required before 14CO2 is released?
Elis [28]

Answer:

14 CO₂ will be released in the second turn of the cycle

Explanation:

<u>Complete question goes like this</u>, "<em>The CO2 produced in one round of the citric acid cycle does not originate in the acetyl carbons that entered that round. If acetyl-CoA is labeled with 14C at the carbonyl carbon, how many rounds of the cycle are required before 14CO2 is released?</em>"

<u>The answer to this is</u>;

  • The labeled Acetyl of Acetyl-CoA becomes the terminal carbon (C4) of succinyl-CoA (which becomes succinate that is a symmetrical four carbon diprotic dicarboxylic acid from alpha-ketoglutarate).
  • Succinate converts into fumarate. Fumarate converts into malate, and malate converts into oxaloacetate. Because succinate is symmetrical, the oxaloacetate can have the label at C1 or C4.
  • When these condense with acetyl-CoA to begin the second round of the cycle, both of these carbons are discharged as CO2 during the isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase reactions (formation of alpha-ketoglutarate and succinyl-CoA respectively).

Hence, 14 CO₂ will be released in the second turn of the cycle.

3 0
3 years ago
Herbivores get energy by eating plants. Plants get energy from sunlight. Why does most of the energy captured by plants never be
qwelly [4]

Answer:

Because they lose most of the energy as heat when they perform metabolic activities

Explanation:

Cells of all living organisms require energy in form of ATP to perform their cellular functions. In an ecosystem, organisms obtain this energy by feeding on one another. However, these energy transfer starts from organisms capable of using sunlight called PRODUCERS e.g plants.

Herbivores, which are PRIMARY CONSUMERS get their energy by feeding on these plants. However, according to the PYRAMID OF ENERGY, which represents the flow of energy in an ecosystem, only a few portion of the energy (about 10%) derived by plants from the sun gets transferred to herbivores. This is because most of the energy (about 90%) is lost as heat when the plants undergo metabolic activities.

8 0
3 years ago
Read 2 more answers
Other questions:
  • How does DNA support the idea that life change over time?
    5·1 answer
  • The earth's plates moved over millions of years, bringing continents and other features of the earth to their present arrangemen
    9·2 answers
  • An infection or the products of infection carried throughout the body by the blood is called:
    12·1 answer
  • Copper is combined with tin to make what alloy?
    7·2 answers
  • One important difference between a myelinated and unmayelinated axon is
    9·1 answer
  • During the development of a new drug, which would be included in the study by the researcher to prevent any bias or unrealistic
    15·1 answer
  • One way that cell maintain *homeostasis* is by controlling the movement of substances across the cell membrane
    5·1 answer
  • (b)
    14·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Does a kangaroo have a dorsal nerve cord notochord?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!