1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldfiish [28.3K]
3 years ago
7

Fossil fuels can usually be found in layers of what?

Biology
2 answers:
Basile [38]3 years ago
5 0
Rock ( I believe so)
Mama L [17]3 years ago
5 0

made up of plankton and plants is what turns into fossil fuels

You might be interested in
The greenhouse effect on Earth keeps it warm enough for liquid water to exist. However, on Venus, the greenhouse effect warms th
timofeeve [1]

Answer:

<u>A. 460°C</u>

or about 900 degrees fahrenheit

6 0
2 years ago
Sporopollenin, found in the _____, protects the pollen grain against UV radiation, dehydration, and pathogen attack.
PSYCHO15rus [73]

Answer: Exine of pollen grain

6 0
3 years ago
A carrier (heterozygous) marries a pure normal skinned person, what is the probability they will have a child that is albino?
Morgarella [4.7K]

Answer:

b

Explanation:

4 0
3 years ago
Complete each statement by using the appropriate word or phrase from the list. Then place the statements in the order of an acti
timurjin [86]

Answer:

1. Potassium

2. increasing towards zero

3. hyperpolarization

4. voltage-regulated Potassium

Explanation:

Membrane potential can be defined as the difference in electric charges inside and outside of a cell. The resting membrane potential (RMP) occurs when there is no net current across the membrane and therefore the cell is in a non-excited state. At the RMP, sodium ions (Na+) are more concentrated inside the extracellular fluid (ECF) than inside the intracellular fluid (ICF), while potassium ions (K+)  are more concentrated inside the ICF. The diffusion of K+ outside the cell triggers its hyperpolarization, by becoming the membrane potential more negative compared to the resting potential. As the potential nears +35 mV, the voltage-regulated potassium channels are open, thereby K+ ions leave the cell down its concentration gradient, while voltage-gated Na+ channels become saturated and inactivate.

8 0
2 years ago
When does the cell have to use active transport?
kati45 [8]


The best answer is D.

In active transport, molecules move against a concentration gradient from areas of lower concentration to areas of higher concentration. This happens a lot in neurons. The membrane proteins are constantly pumping ions in and out  to get the membrane of the neuron ready to transmit electrical impulses.

In active transport , energy is required to move molecules across the cell membrane. Carrier proteins are needed for this e.g. proteins of the GLUT family which transport glucose molecules across the cell membrane. Carrier proteins are very specific. GLUT proteins will only move glucose molecules and not sodium or calcium. There are hundreds of types of carrier proteins.


4 0
3 years ago
Other questions:
  • Some of the birds that could not compete with the honey creepers were successful living on other islands. State one reason why t
    13·1 answer
  • If a mirror's surface transparent, translucent, or opaque? How do you know?
    7·2 answers
  • Using the scientific method, a(n) _____ must be tested as the focus of any experiment.
    9·2 answers
  • During cell division, or mitosis, an exact duplicate of the original cell is produced. The instructions for cell division are fo
    13·1 answer
  • When exercising, you have little influence over your personal safety. please select the best answer from the choices provided. t
    11·2 answers
  • What is the main human activity that can contribute to climate change?
    14·2 answers
  • Which are the factors that scientists use to classify orders of soil
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A _________ is an organic compound that must be obtained from the diet and is needed to sustain life.
    10·1 answer
  • Bioaugmentation involves Group of answer choices adding nitrogen and phosphorus to an area in need of remediation. adding specia
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!