1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timurjin [86]
3 years ago
11

Heterotrophic organisms used the process of fermentation to nourish. What is fermentation?

Biology
1 answer:
Mama L [17]3 years ago
8 0
Fermentation is a type of chemical process which enables heterotrophs to obtain energy without oxygen . Heterotrophs uses procedure of fermentatation to cultivate because in process of fermentation enzymes are the catalysts and they provide energy to heterotrophs
You might be interested in
Explain why offspring of plants exposed to radiation may have characteristics not found in the original population.
iVinArrow [24]
Radiation can damage DNA. This could result in a change in the proteins which make up the plant's physical structure. 

<span>For example, a plant might have a gene for purple pigment which makes its flowers purple. Radiation might change the DNA sequence so that the directions for making the purple pigment tell it to stop prematurely, and the result might be white flowers rather than purple flowers.</span>
5 0
4 years ago
What are the steps in cell division in order
elena-s [515]

Answer:

These phases are prophase, prometaphase, metaphase, anaphase, and telophase. Cytokinesis is the final physical cell division that follows telophase, and is therefore sometimes considered a sixth phase of mitosis.

5 0
3 years ago
Covalent bonds form when electrons are________<br> shared<br> transferred<br> staying in place
Alona [7]

Answer: Shared

Explanation: A covalent bond involves electrons being shared between atoms.

3 0
3 years ago
Read 2 more answers
What causes the
White raven [17]

Answer:

B

Explanation:

B is the answer because the magnetic field of the earth attracts sun Ray's

5 0
2 years ago
At what stage of erythropoiesis is the developing red blood cell released into the circulation
Lisa [10]
Erythropoiesis is the formation of the red blood cells a process which takes place in the bone marrow. All blood cells are formed in the bone marrow, a soft, highly cellular tissue that fills the internal cavities of the long bones. It takes place in 8 stages where the first seven steps takes place within the bone marrow and after the 7th step the red blood cell is released into the blood stream as reticulocyte which then matures to erythrocyte after 1-2 days.
3 0
4 years ago
Other questions:
  • A pea plant that has round seeds are dominate over winkled seeds in pea plant. Fill in the punnett sqares and determine the expe
    14·1 answer
  • Where is the majority of the body's magnesium found?
    10·1 answer
  • When water freezes, it contracts or expands
    11·2 answers
  • What gets passed from one cell to on other in sexual reproduction
    8·1 answer
  • A dichotomous key is a
    11·1 answer
  • Hi, can someone answer this I need this as soon as possible? I would really appreciate it.
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How did rudolf virchow contribute to the cell theory
    8·1 answer
  • What is individual object analysis
    7·1 answer
  • In what cell organelle is the green pigment, chlorophyll found?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!