1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
belka [17]
3 years ago
14

Give me an example of commensalism

Biology
2 answers:
adelina 88 [10]3 years ago
8 0

Answer:

look on goo,gle

Explanation:

Musya8 [376]3 years ago
5 0
A example of commensalism is Tree frogs use plants as protection. Another is
Nurse planets are larger plants that offer protection to seedlings from the weather and herbivores.
You might be interested in
coraline analyzed the data and stated that the better measure of center for the women is the median. is coraline correct? explai
Usimov [2.4K]

According to Coraline's analysis of the data, the median is a better indicator of the center for women. After analyzing the data, Michaela concluded that the mean is a better indicator of the center for women.

What is coraline?

The median would be the most appropriate measure of center because of the slight skew. The statistics students analyzing the data were asked to study. The perceived under representation of female speakers at prominent scientific meetings is currently a popular topic for discussion. coraline analyzed the data and stated that the better measure of center for the women is the median. Cardiac CT was performed on a total of 169 patients with HIV and 81 controls. Those who had HIV had more epicardial fat volume.

To learn more about female speakers  from given link

brainly.com/question/27995786

#SPJ4

8 0
1 year ago
Which occurs during the Krebs cycle?
seropon [69]

Answer:

The correct answer is break down of pyruvate

Explanation:

Krebs cycle is one of the most significant process of aerobic respiration.During krebs cycle pyruvate is broken down to acetyl CoA which interacts with oxaloacetate to form the first metabolite of Krebs cycle known as citrate which contain 3 -COOH group That"s why krebs cycle is also termed as Tricarboxylic acid cycle.

3 0
4 years ago
Which of the following is NOT a major characteristic used to identify minerals? a. hardness c. density b. magnetism d. luster Pl
Alex73 [517]

The answer is magnetism (B)

3 0
3 years ago
Read 2 more answers
What is a part of meiosis but not mitosis ?
Alexandra [31]

I think genetic variation, but i'm not completely sure

7 0
4 years ago
Which of the following statements is consistent with the principle of competitive exclusion? Which of the following statements i
Elodia [21]

Answer:

Even a slight reproductive advantage will eventually lead to the elimination of the less well adapted of two competing species.

5 0
4 years ago
Other questions:
  • Type of joint found in the shoulder and hip?
    7·2 answers
  • Punnett squares are used to show possible combinations of alleles or to predict the probability of a trait occurring in offsprin
    10·2 answers
  • What change could a student measure to collect data about the rate of photosynthesis in a certain type of algae when it is expos
    7·1 answer
  • Secretions of the pituitary gland are most directly regulated by the
    15·1 answer
  • Which pair of organisms is most closely related to primates? amphibians and rodents ,crocodiles and amphibians ,rodents and rabb
    9·2 answers
  • Which of the following is produced by adding 1% to 5% agar to nutrient broth that is then boiled and cooled?
    7·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Help pleaseeeeeeellllll
    13·1 answer
  • In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR)
    7·1 answer
  • A paper plant produces water pollution during the production process. If the government forces the plant to internalize the nega
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!