1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
madam [21]
3 years ago
10

Mrs. Leugs wants to paint ONE wall in her house. The rectangular wall has dimensions of 13 ft by 7 ft. If one jar of paint cover

s 40 ft^2, how many jars of paint will she need to buy? I NEED WORK SHOWN FOR MY ASSIGNMENT.
Mathematics
1 answer:
3241004551 [841]3 years ago
7 0
You will need three jars of paint I believe
You might be interested in
Which expression is equivalent to 5^3?
AleksAgata [21]

Answer:

C and D

Step-by-step explanation:

5^3 - 5^0 = 125 - 1 = 124, so it's not A

5^12 / 5^4 = 5^(12-4) = 5^8, so it's not B

5^7 * 5^-4 = 5^(7+(-4)) = 5^3, so it can be C

5^0 * 5^3 = 5^(0+3) = 5^3, so it can be D

5 + 5^2 = 5 + 25 = 30, so it can't be E

3 0
2 years ago
one foot of water column produces a pressure of 0.433psi . a gauge at the bottom of a water tower reads 44 psi. how high is the
Klio2033 [76]
The answer to the psi is 19.6
7 0
3 years ago
A toy company makes rectangular sandboxes that measure 6 feet by 5 feet by 1.2 feet. A customer buys a sandbox and 40 cubic feet
Iteru [2.4K]

Answer:

Customer has bought too much sand

Step-by-step explanation:

Given that the dimensions (Length, Width and Height) of rectangular box are = 6,5, 1.2.

Volume of a rectangular box = Length * Width * Height

=> 6*5*1.2

=> 36 cubic feet

As mentioned, customer bought a sand box and <u>40 cubic feet of sand.</u>

So,

Volume of rectangular box (R) = 36 cubic feet

Volume of Sand (S) = 40 cubic feet

From analysis

S > R

Which shows that the capacity of sandbox is 36 cubic feet and volume is 40 feet that is a little greater than desired capacity.

Therefore, customer has bought too much sand.

4 0
3 years ago
A cone has a radius of 6 inches and a height of 20 inches. What is the exact volume of the cone? A) 720π in3 B) 80π in3 C) 240π
SIZIF [17.4K]
The answer is c. 240π
V=πr² h/3 =π×6²× 20/3 ≈753.98224
3 0
3 years ago
Read 2 more answers
Matt paid $55 at a restaurant. That amount included a 10% tip. What was the check amount before the tip?
marissa [1.9K]
As long as there was no tax, the check amount *before* the tip should be just $55. With the tip, it would be $60.50.
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the perimeter of rhombus wxyz?
    7·2 answers
  • How many lines are determined by two points? <br><br> 0 <br><br> 1 <br><br> 2 <br><br> infinite
    6·2 answers
  • If jill has 2 more cats than dogs,how many fewer dogs does jill have
    6·2 answers
  • Evaluate the expression,
    12·1 answer
  • Can someone please answer this question? Btw the picture is upside down(I dont know why it is)
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 3x-x+4=10 I really need help please help me. Xoxo
    13·1 answer
  • So I'm calculating the areas of squares and rectangles.
    10·1 answer
  • Solve the equation, Write one solution, No solution, Infinitely Many Solution
    15·2 answers
  • Plz help!!!!!!!!??????
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!