1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuliya22 [10]
2 years ago
9

15) Study the food web, What conclusions can be drawn from analyzing this food web?

Biology
1 answer:
saul85 [17]2 years ago
8 0

Answer:

C) I, III, and IV only

Explanation:

l. All the energy contained within the organisms

lll. The hawk is the top predator.

IV. Energy is transferred from organism to organism in this food web,

You might be interested in
Fffffffffffffffffffffff<br>f
sdas [7]

Answer:

06

Explanation:

8 0
3 years ago
Read 2 more answers
A cross between a red cow and a white bull produces an offspring with a roan color (a spotted red-and-white color). This exhibit
Delvig [45]

Answer:

co-dominance

Explanation:

in co-dominance both parents are dominant

3 0
2 years ago
What is a non-renewable resource and what are some examples?
kolbaska11 [484]

Answer:

See below

Explanation:

Non-Renewable resources are those resources which once used cannot be used again. They cannot be recycled again.

<u>Example:</u>

1) Coal

2) Oil

3) Natural Gas

\rule[225]{225}{2}

Hope this helped!

<h3>~AH1807</h3>
3 0
3 years ago
Read 2 more answers
What is the best explanation for the observation that eukaryotes that seem superficially simple can have much larger genomes (in
brilliants [131]

Answer:

Some organisms have a tremendous amount of noncoding DNA, like repetitive sequences.

Explanation:

DNA is the genetic material in almost all the living organisms but except in case of viruses that has RNA as their genetic material. DNA consists of the four nitrogenous bases, pentose sugar and phosphate group.

Prokaryotes have simple body organization and structure because of the sall amount of DNA. Eukaryotes have complex body organization because they have large amount of the transposons, repetitive sequences and non repetitive DNA sequences.

Thus, the correct answer is option (b).

3 0
3 years ago
In cats having hair is dominant (H) over not having hair (h). If a male cat that is heterozygous for hair is crossed with a hair
alexgriva [62]
A heterozygous cat has a genotype Hh
A hairless cat has a genotype hh
When crossed, the results could be any of the following:
Hh (with hair)
hh (hairless)
There is a 50:50 chance or 1: 1 ratio that the offspring will have hair.
7 0
3 years ago
Other questions:
  • Which of the following organisms would be members of a pioneer community on bare rock? A. grass B. lichens C. herbs D. moss E. t
    14·1 answer
  • Why is food waste a growing concern? describe how some communities are addressing the food waste issue?
    9·1 answer
  • Which organs are responsible for producing fluid to give sperm nourishment and motility?
    7·2 answers
  • Before classifying insects into different orders, review the larger classifications for insects:
    14·1 answer
  • Why even though all cells are composed of the same basic parts, the structure of cells can be very different?
    14·1 answer
  • The virus that causes chicken pox contains DNA. It reproduces inside the cells of living organisms. The virus is not made of cel
    10·1 answer
  • What is an important characteristic of the plant cell wall?
    9·2 answers
  • What is antigen?What does it include?What is its function?
    7·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What is the structure of a codon?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!