1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
3 years ago
9

What occurs during interphase of the cell cycle?

Biology
2 answers:
Thepotemich [5.8K]3 years ago
7 0
A is the correct answer for this questions
Lisa [10]3 years ago
3 0

Answer:

A. The chromosomes are split

Explanation:

That’s just what happens bud.

You might be interested in
18. Aerobic respiration produces more cellular energy than respiration in an anaerobic environment.
Ahat [919]
I’m pretty sure the answer is true
5 0
2 years ago
Read 2 more answers
Asi todas las células son muy pequeñas. ¿Qué limitaciones físicas y metabólicas determinan el tamaño celular? ¿ A qué problemas
N76 [4]

Answer:

- Limitación física: la relación superficie volumen es baja para un intercambio eficiente de sustancias con el medio

- Limitación metabólica: en principio no existen limitaciones metabólicas  

Explanation:

La membrana celular es una estructura fundamental para el funcionamiento celular, ya que de la membrana celular depende el intercambio de nutrientes y desechos por parte de la célula con su entorno (medio extracelular). En células muy grandes la relación entre la superficie cubierta por la membrana y el volumen celular es muy baja, lo cual dificulta el intercambio de compuestos (tanto nutrientes como desechos) con el medio extracelular. Por otro lado, los mecanismos metabólicos en principio no deberían verse afectados por el tamaño celular. Por ejemplo, los perfiles metabólicos de expresión génica son independientes del tamaño celular y están adaptados a diferentes tipos celulares, desde una célula huevo que es proporcionalmente varias veces más grande que un célula diferenciada la cual sin embargo no ha perdido la capacidad de dividirse, un ejemplo de esto son las células cancerosas derivadas de células epidérmicas diferenciadas las cuales poseen la capacidad de dividirse y de proliferar indiscriminadamente.

5 0
3 years ago
The most important role of pigments in photosynthesis is to _____.
m_a_m_a [10]
Make the plants own food source.
6 0
3 years ago
Which is the main function of carbohydrates in the body?​
STatiana [176]

QUESTION:- Which is the main function of carbohydrates in the body?

ANSWER:- carbohydrates r the main souce of energy as they release enough amount of energy with the help of easy breakdown

5 0
3 years ago
Read 2 more answers
What is the scientific definition of energy? A. the ability to use the stored potential of an object B. the ability to use the c
dusya [7]
The answer is C. The ability to use an applied force in order to make an object move.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which viral life cycle can be triggered to enter into the other one? What triggers that process?
    9·1 answer
  • In corn, a dihybrid for the recessives a and b is
    6·1 answer
  • Females inherit two x chromosomes and males inherit one x chromosome. however, there is not a double dose of x gene products in
    9·2 answers
  • In what form is carbon found in the atmosphere?<br> ОСО,<br> ОС6Н12О6<br> ОН,0<br> ОАТР
    10·2 answers
  • Which is one difference between the way terrestrial planets and Jovian planets formed?
    5·2 answers
  • What is the last step for amino acids to do
    14·1 answer
  • The most common cause of desertification is
    15·2 answers
  • Functional groups confer specific chemical properties to the molecules of which they are a part. In this activity, you will iden
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Please help me :( the author believes that Charles Goodyear was a dedicated scientist who kept improving on his work. Which sent
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!