1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
REY [17]
3 years ago
11

In which country do citizens have the fewest voting rights A. Iran B. Israel C. Turkey D. Saudi Arabia

Geography
2 answers:
Blababa [14]3 years ago
5 0
D Saudi Arabia .... i think
wolverine [178]3 years ago
5 0
Saudi Arabia has fewest voting rights.
You might be interested in
“The Amazon rainforest is a highly biodiverse ecosystem”. Substantiate this statement.
nordsb [41]

Answer:

Amazon rainforest is a diverse and rich forest found in the Southern part of America-precisely Brazil, Peru, Columbia. And, also, some minor part are found within  Venezuela, Ecuador, Bolivia, Guyana, Suriname and French Guiana.

<em>It is also known as the Amazon jungle. Being a bio-diverse ecosystem means that, it is with an estimated 390 billion individual trees divided into 16,000 species which could be found inside it. </em>

<em>Most of the species of trees in any part of the world can be found inside the forest. Also, some rare and unknown species could also be found inside it.</em>

Explanation:

7 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
During which eon did invertebrates begin to populate the earth?
Sidana [21]
<span>c. phanerozoic eon Im like 25% sure</span>
7 0
3 years ago
Where does Canada export it's surplus oil
Xelga [282]
They export from the United States.
8 0
3 years ago
Read 2 more answers
Whats the square root of 69
tangare [24]
The square root is 8.3066238
7 0
3 years ago
Other questions:
  • The most recent analyses of polar ice cores have given us the ability to profile global climate change back as far as ________ y
    12·1 answer
  • 13. You budget $100 for parking each month. Each day you use the downtown
    13·2 answers
  • Which parts of the earth are prone to the cyclone?
    7·2 answers
  • Pattern of winds near the equator
    12·1 answer
  • What were the major events of Russian History? List 5
    7·1 answer
  • A man had stolen his neighbor's money, and later lost his job. This represents the Hindu principle of
    12·1 answer
  • A flood, a dust storm, a volcano, or a forest fire. Write about how you think it changes ecosystems
    12·2 answers
  • From among the benefits of trees and fruit trees which do you think is the most important and why
    9·1 answer
  • Question 16 (5 points)
    11·1 answer
  • Find the longitude of a place 'X' where the time is noon when it is 4pm at greenwich​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!