1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dominik [7]
3 years ago
10

Photosynthesis provide food and oxygen to all the living organism Is this true or False ???​

Biology
2 answers:
Arisa [49]3 years ago
3 0

Answer:

True

I hope this helps!

Katena32 [7]3 years ago
3 0
True!!
should help :)
You might be interested in
The human immunodeficiency virus (hiv) that causes the disease known as aids selectively infects ________ cells.
Furkat [3]

The human immunodeficiency virus (HIV) that causes the disease known as aids selectively infects helper T cells (CD4+).

This retrovirus also infects macrophages and dendritic cells. When CD4+ T cell numbers decrease below a critical level (due to the killing of this cells with different mechanisms), cell-mediated immunity is lost. As a result, the body becomes progressively more susceptible to infections, leading to the development of AIDS.

<span> HIV can be transmitted only via body fluids like blood, semen, pre-seminal fluid, rectal fluids, vaginal fluids, and breast milk, which means that people usually get or transmit HIV through sexual behaviours and use of the needle. For HIV infection, these fluids must come in direct contact with a mucous membrane or damaged tissue. Another way is to be directly injected into the bloodstream (from a needle for example).</span>

7 0
3 years ago
Small circular rna molecules that infect plants and disrupt their growth ______.
puteri [66]
<span>These are viroids. They are some of the smallest types of matter that have been shown to take on the properties of living beings. They have the ability to replicate, while not having many of the mechanisms that are commonly found in DNA and required for them to replicate.</span>
5 0
3 years ago
A student drew the diagram below to model the process of binary fission, which is a type of asexual reproduction.
Leno4ka [110]
The answer would be: <span>Binary fission involves a single parent cell, so there is only one set of genetic information that can be duplicated and passed on to the daughter cells.

If you see the picture, it is clear that there is only 1 parent involved in binary fission. This will exclude the first and third option. 
The genetic duplicated before splitting, so the cells should have an equal number of parent genetic material, not halves. This will exclude the second option.
</span>
8 0
3 years ago
Read 2 more answers
What two things can alter the shape and function of an enzyme
mars1129 [50]

Temperature can cause an enzymes shape and function to alter due to the fact that once an enzyme reaches its optimum level, if it goes over it begins to denature. If the temperature is below optimum, then an enzyme will work at a slower rate.  Also, the pH can affect an enzyme.  

6 0
4 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Other questions:
  • What did rutherford gold foil experiment suggest about the structure of an atom?
    14·1 answer
  • The integument consists of the epidermis, which is composed of keratinized stratified squamous epithelium, and the __________, w
    9·1 answer
  • What event marked the end of the mesozoic era and the beginning of the cenozoic era
    15·1 answer
  • What is the importance of the nitogen cycle
    7·1 answer
  • How do neurofibrils differ from nerve fibers?
    7·2 answers
  • Which macromolecules provide instructions for growth?
    6·1 answer
  • Which of the following molecules do plants need to carry out photosynthesis?
    9·1 answer
  • What happens to energy from the sun as it travels
    11·2 answers
  • Mangrove swamps are coastal wetlands found only in tropical zones true or false
    6·1 answer
  • Genotypes and phenotypes ​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!