1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
trapecia [35]
3 years ago
12

What type of organism would most likely be found in place of the question marks?​

Biology
1 answer:
ruslelena [56]3 years ago
8 0

Answer:

Decomposers

Explanation:

The diagram in this question illustrates a food web, which is a series of interlinked food chains in an ecosystem. In a food chain as depicted in the image, the arrows point to the organism that feeds on another organism. For example, an arrow is pointing from Idaho fescue to an Elk meaning that the elk will feed on that plant.

Different trophic levels constituting organisms exists in the food web including; producers (plants), primary consumers, secondary consumers, tertiary consumers etc. However, as observed in the image, a general arrow carrying along all the organism is pointing towards the organism in the question mark. This organism is called DECOMPOSER.

A decomposer, usually a microorganism, is an organism that breaks down dead organisms and returns the nutrient to the soil for recycling. All organisms in the food web will eventually die and when they do, they'll be decomposed by a decomposer. This is why the arrow pointing towards the decomposers include all organisms.

You might be interested in
In the human brain, a great deal of synaptic pruning occurs in early childhood. This pruning appears to be:_______.
Alex

Answer: D. An adaptive process that allows children to deal more efficiently with their environment.

Explanation:

Synaptic pruning is a natural process between early childhood and adulthood which occurs in the brain. The brain removes the extra synapses during synaptic pruning. Synapses are brain structures that allow the neurons to transmit to another neuron an electrical or chemical signal.  

Synaptic pruning is thought to help the brain transition from adolescence, when it can quickly learn and make new connections, to adulthood, when it is much more stable in its structure, but can concentrate on a single question for longer and conduct more complex thinking processes. Synaptic pruning make brain more adaptive to the external environment in early ages.

Hence, the correct option is D. An adaptive process that allows children to deal more efficiently with their environment.

4 0
3 years ago
List the four eras on the geologic time scale describe one identifying type of organism from each era
OleMash [197]
<span>Cenozoic
</span><span>Mesozoic
</span><span>Paleozoic
</span><span>Precambrian </span>
6 0
4 years ago
Read 2 more answers
The equilibrium number of doctor visits in this economy is500 visits per year, while the equilibrium price is per visit.
Deffense [45]

Answer:

R10 is the equilibrium price

5 0
3 years ago
A group of students is learning to identify each organ of the human body by looking at images. The students identify the stomach
trasher [3.6K]

Answer:

D

Explanation:

The acids in your stomach break down the food you eat

6 0
3 years ago
The one time my cousin ___(e)d skydiving, the result was a ___. her parachute didn't open, and she was injured so badly in the f
Nikolay [14]
The answer in the spaces provided is venture and calamity. The answer is venture because sky-diving is considered to be a an activity that seems to be adventurous and dangerous in which venture means while it also results into calamity because it causes distress in which she has injured herself.
4 0
3 years ago
Other questions:
  • How do the effects of climate change differ from the effects of habitat alteration, invasive species, overharvesting and polluti
    15·2 answers
  • As they multiply, die and decompose, algae deplete the ocean’s surface layers of oxygen. Often, the large amounts of farm fertil
    6·2 answers
  • For the average young adult female resting in a reclined position, the heart pumps out approximately 5 liters of blood per minut
    6·1 answer
  • Why does the scientific establishment sometimes reject new ideas?
    8·2 answers
  • CROSSWORD PUZZLE: A specific product of a drug, formed by the chemical processes in the body that break down the drug (10 letter
    7·1 answer
  • How many planets are there in the solar system?
    15·2 answers
  • What did Gregor Mendel discover about heredity?
    13·2 answers
  • Which type of molecule do whales use for energy storage and insulation?
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • You can see some blood vessels on the outside of the hands specially in older people. Are those veins or arteries? How can you c
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!