1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notsponge [240]
2 years ago
5

Hi! I need help i posted this already but people only replied for the points :(

Geography
1 answer:
ryzh [129]2 years ago
4 0

Answer:

ill do my best (im not going to give you answers to copy and paste though)

Explanation:

Explain how English is a product of place and time. Use two specific examples to support your response. (2pts)

english was created and changed through time. it is a language like others based on Latin. (you can add on)

2. Explain how Colonialism affected global patterns of the English language. Use examples from two geographic regions to support your response. (2 pts)

um, I would say you could use spain england as an example. they had some effect on

3. Identify and explain two factors that are solidifying English as the Lingua Franca of the world Use specific examples to support your response. (4 pts)

I have no idea what this means.

You might be interested in
Pls help me with this question ​
svlad2 [7]

Answer:

From bottom to top - tropospher -> ozone layer -> stratosphere -> mesosphere -> thermosphere -> exoshpere

Explanation:

3 0
2 years ago
New crust is being produced at a mid-ocean ridge. How does the affect the total size of the crust?
Jet001 [13]

Answer:

The crust size remains constant because the older crust is melted at subduction zones.

Explanation:

The crust is constnatly created on Earth, but the crust is constantly getting destroyed as well. This situation leads to the total size of the crust being roughly at the same level, or rather constant, as one side a new one emerges, while at the same time, on the other side it gets destroyed.

The vast majority of the new crust is formed where there are divergent plate boundaries. Here, a gap opens up between the plates that move away and magma is constantly rising to the surface and creates new crust. When it comes to the destruction of crust, it occurs at subduction zones. Here, one plate moves below another plate, and as it does it reaches the upper mantle where it gets melted and recycled because of the high temperatures and pressure.

3 0
3 years ago
Honduras has a economy in which people produce goods for their own use.
VLD [36.1K]
So what's your question?
3 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which of the following events can produce an earthquake?
mart [117]
Earthquakes usually happen when a plate underground rubs together.
Hope that helps!
7 0
3 years ago
Other questions:
  • Two major sources of energy, coal and oil shale, are considered ________ sedimentary rocks.
    14·1 answer
  • Prior to the 1500's, most people accepted the view that the planets within our solar system revolved around
    9·1 answer
  • Which mountain range forms the continental divide?
    7·1 answer
  • After the end of communism, the standard of living dropped for many Russians due to _____.
    9·2 answers
  • What is the longitude of the prime meridian?
    8·1 answer
  • What techniques are engineers using to reduce earthquake damage in Haiti ?
    15·1 answer
  • 3. If 500 people in Country A are farmers, what is the agricultural density<br> of Country A?*
    10·1 answer
  • Over time is Iceland going to get bigger get smaller or stay the same size
    5·1 answer
  • where is mt everest located and which district and please give me also a height of itbin meter not in feet....☺️​
    14·1 answer
  • What is the social impact of globalisation on developing countries
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!