1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
s344n2d4d5 [400]
3 years ago
11

5. What is the difference between locomotion in plants and animals?pls help he guyzzz ​

Biology
1 answer:
sp2606 [1]3 years ago
4 0

Answer:

Animals can move, but plants cannot

Explanation:

Locomotion in humans and bipeds is accomplished through walking on legs. In other animals, it can be accomplished through walking on four limbs, flying, or swimming. In cells, cilia and flagella are used to move about. However, since plants are not capable of moving themselves, there is no locomotion of plant species.

You might be interested in
What is the molecule rRNA a component of
Tpy6a [65]

rRNA is a component of ribosomes. Its name is ribosomal RNA
7 0
3 years ago
What is the MAIN purpose of the Clean Water Act (CWA)?
erica [24]
Regulating pollutant discharges into the waters of the United States
3 0
3 years ago
Read 2 more answers
Viruses _____.
Montano1993 [528]

viruses are tiny bundles of genetic material which is carried in a viral coat.

<u>Explanation:</u>

  • The virus is generally a parasite that needs a host to become active and to reproduce. It cannot reproduce without the host.  
  • The tiny bundle consists of genetic material and protein. The virus consists of capsid and nucleic acid. This capsid is said to be the protein coat.  
  • This capsid consists of either  RNA or DNA. virus replicate themself within the host body by using its genetic material along with the mechanism of the host.  
  • Thus after replicating the virus need to get out of host cell, It is performed by two types budding or lysis( bursting the host cell ).

6 0
2 years ago
Lipids ae made of C H O, C H O N
melomori [17]

Answer:

cho

Explanation:

4 0
3 years ago
Examples of an extinct organism??
Lesechka [4]

Answer:

Dodo.

Great Auk. ...

Stellers Sea Cow. ...

Tasmanian Tiger. ...

Passenger Pigeon. ...

Pyrenean Ibex. ...

Baiji White Dolphin

7 0
2 years ago
Other questions:
  • Multiplication is caused by
    12·2 answers
  • Which statement best describes science?
    12·2 answers
  • An abnormal, rounded, solid lump above, within, or under the skin is a(n):
    6·1 answer
  • OPEN ENDED QUESTION
    9·2 answers
  • Why is DNA more accurate than examining physical traits in determining evolutionary relationships? Is there any case in which ph
    5·2 answers
  • When does DNA replication(make a copy of itself)?
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • According to this article, why does the immature prefrontal cortex lead to<br> conflict for teens?
    10·1 answer
  • A relationship between organisms where one member benefits and the other is harmed is called ______.
    14·1 answer
  • Briefly describe two ways that a cytosolic protein (fully translated) can be targeted to the cytoplasmic face of the plasma memb
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!