1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DochEvi [55]
3 years ago
11

Required Info:

Biology
1 answer:
hammer [34]3 years ago
8 0
J bbbbbjjbbbbbbhhjbbbbbb
You might be interested in
How is the density of an object calculated
seraphim [82]
Density=mass/volume this the density equation. hope it helps
5 0
4 years ago
Read 2 more answers
Which is one way that analyzing ice benefits scientists who study ancient climates?
GarryVolchara [31]

Answer:

The answer is B

Explanation:

got it right on unit test review

8 0
3 years ago
Difference between olfactory nerve and auditory nerve​
kow [346]

Answer:

Explained below

Explanation:

1) Olfactory nerves are responsible for our sense of smell while auditory nerves are responsible for our sense of hearing.

2) Olfactory nerves are the shortest nerves and are those that enter the skill through the cribform plate from the ethmoid zone while auditory nerves is one out of two parts of the vestibulocochleer which is described as a cranial nerve that's present in amniotes. The other part is the vestibular nerve.

3 0
3 years ago
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
Muscle Cells contain many mitochondria. Explain Why? Pls Pls Pls Help
VashaNatasha [74]

Explanation:

Muscle cells are assiciated with a large number of mitochondria as they require more ATP (energy) to function than other cells. They need this because of their frequent contraction and relaxation, which requires more ATP than average cells.

8 0
3 years ago
Other questions:
  • Which unit consists of a group of people and the place where they live
    13·2 answers
  • Much of the Florida landscape is built upon limestone. Frequent rains seep down and erode the limestone as the rainwater travels
    9·1 answer
  • Explain how a mutation causing resistance to pyrethrins and pyrethroids would spread through a population of bed bugs that are b
    13·2 answers
  • Identify the significance of the "fairy tale of the egg and the sperm," and "Man the Hunter, Woman the Gatherer" narratives in U
    14·1 answer
  • What does hydra mean in science??????
    9·2 answers
  • Is water that falls from the atmosphere and reaches Earth's surface.
    6·1 answer
  • List three reasons why the connective tissue sheaths of skeletal muscle are important
    12·1 answer
  • Plants do not adapt to their environment because they do not compete for resources.
    10·2 answers
  • (GIVING BRAINLIEST!!)
    14·2 answers
  • How are properties of water related to each other
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!