I need your help pls <3

Biology

1 answer:

SVEN [57.7K]2 years ago

3 0

Answer:

C is not true, biotic compounds do in fact need abiotic factors.

You might be interested in

Aneli [31]

Answer:

Theeeee answerrrrrrr isssss

tissues

4 0

2 years ago

Compare the two processes: mitosis and meiosis. Can you identify the the true statements about the two? Meiosis results in four

Alborosie

Answer:

The correct statements are:

Meiosis results in four haploid daughter cells.
During meiosis, the 2N mother cells produce N daughter cells.
In both processes, DNA replication must occur.
Mitosis is responsible for genetic continuity; in higher organisms, it is essential for growth and repair.

Mitosis is a type of cell division in which a parent cell is divided into two identical daughter cells. Each daughter cell contains identical genetic material as that of the parent cell.

It plays important role in growth and repair of cells and tissues in multi-cellular organisms.

Meiosis is a type of cell division in which a parent cell is divided to produce four daughter cells. Each daughter cell contains exactly half the genetic material (chromosomes) as that of parent cells

It plays important role in the production of gametes (eggs and sperms) in sexually reproducing organisms.

Before either cell division, the DNA is replicated in the S or synthesis phase of the cell cycle.

5 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein