1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OlgaM077 [116]
3 years ago
15

What is the role of a pioneer species in primary succession?

Biology
1 answer:
alexira [117]3 years ago
3 0

The role of a pioneer species is to produce the soil.

You might be interested in
As resources in a population become less available population growth will
sweet-ann [11.9K]
As resources in a population become less available, the populationa. declines rapidly because there is nothing the people could use to survive.

When the exponential phase of a logistic growth curve of a population ceases
 Hope this helps!

6 0
3 years ago
Read 2 more answers
Which statement describes why zebra fish experience similar genetic diseases as<br> humans?
Aleksandr [31]

Answer:

Zebra fish have an omnivorous diet similar to that of humans. Zebra fish have nucleotide sequences similar to those of humans.

Explanation:

google

3 0
3 years ago
Can someone help me with this. I´ll give you the BRAINLEST!!
Marina86 [1]
What’s the question tho?

7 0
3 years ago
Read 2 more answers
Why the plants in a space are grown in enclosed containers
Leona [35]
Hey In addition to providing fresh food, growing vegetables in space has other benefits, both atmospheric and psychological. Plants remove harmful carbon dioxide from the air and replace it with needed oxygen.
5 0
3 years ago
1. Why do scientists use the scientific method? *
jeka94

1. Answer: to answer questions about the natural world

The aim of scientific method is to answer a question that the scientist have. To answer the question, the scientist need to design a research or observation. If the research is flawed, the result might not match with the scientist aim and the conclusion will be wrong. Scientific method can be used to help design the research so it will have less flaw


2. Answer: fertilizer

The student wants to determine the effect of a certain brand of liquid fertilizer on the growth of ivy. The fertilizer are hoped to influence the growth of the ivy. Independent variable is the variable that hoped to influence the dependent variable. So, the independent variable would be fertilizer.

3. Answer: soil; light

Control variable is the variable that could influence the independent variable, but doesn't want to be observed. Control variable should be made same so it wont influence the result.  In this case, the plant use the same amount of soil. The plant also put in front of a same window, so they should get the same amount of sunlight.


4. Answer: Humidty

The scientist wants to determine if humidity affects chirping in crickets. The humidity hoped to affects the chirping in crickets. Independent variable is the variable that hoped to influence the dependent variable. So, the humidity is independent variable while the number of chirping is the dependent variable.

5. Answer: dependent variable

The scientist is testing the efficiency of various microwaves by measuring the temperature of water. The microwaves is hoped to influence the temperature of the water. So, the temperature would be the dependent variable of the experiment and the microwaves will be the independent variable


6. Answer: water; air; soil


Abiotic factor consist of factor that made of non-living things. Water, air and soil is not a living things. Animals like elephant should be clearly living so they are biotic factor. Grass and tree could not move freely like animal and hard to determine if still living or not, but they should be considered as living thing.

7. Answer: an alligator submerges itself under water to stay cool in the summer; an alligator suns itself on the shore to raise its body temperature.

If a bird picks food from alligator teeth, it would be interaction of biotic factor with biotic factors. Alligator trying to control their body temperature by sunbath or submerge would be interaction between abiotic factor(sunlight, water) with biotic factor(alligator). Oxygenated water is interaction between abiotic factor(water) with abiotic factor(air/oxygen).

8. Answer: strong adhesion

Water has high heat capacity  which makes it temperature hard to changes. It will need more energy/heat to change the temperature of water when compared to air. Adhesion of water makes it could stick to other things while cohesion makes the water stick to itself. The force that cause molecules of water to stick to the sides of a drinking straw would be adhesion.

9. Answer: 14

oxygen has atomic number 8 and atomic mass of 14. The atomic number show the amount of proton and electron that the oxygen has while the atomic mass show the sum of proton and neutron. The number of protons and neutrons in stable oxygen would be 14, same as the atomic mass.

10.  Answer: protons; neutrons


Protons and neutrons could be found in the nucleus of the atom while the electron is orbiting in the outer layer. The mass of the atom mostly contributed by the protons and neutrons while the electron is too small and their mass is negligible.

11. Answer:  ions are atoms with extra electrons or too few electrons; isotopes are atoms with extra neutrons or too few neutrons; isotopes are radioactive

When an atom has less electron it will be called cation while the atom with more electron called anion. Isotopes have different number of neutrons which make some of them become radioactive. Isotope should have the same number of electrons.

12. Answer: it has 4 valence electrons, so it can make 4 strong bond with other atoms.

Carbon made most of the organic compound. Carbon can be found in carbohydrate, protein and lipid. It has 4 valence electrons which enable 4 slot of covalent bond with oxygen and hydrogen which allow those 3 molecule to have many type of bonds.

13. Need image to answer

14. Answer: The compound has different properties, because the bonds cause structural changes of the elements

Compound will have different properties compared to the element that makes it. Table salt is made of natrium and chlorine atom. The natrium element will explode when exposed to water while natrium chloride is found most in the sea.

15. Answer: exothermic

Reaction that produce energy will be called exothermic while reaction that absorb energy called endothermic. If the reaction cause light and explosion, then the reaction should produce energy and called exothermic. The ion or compound should have no relation in this.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Certain cells contain ____________, which are differentiated structures that carry out many of the metabolic tasks important to
    13·1 answer
  • Which type of psychologist would someone with a speech impediment be most likely to visit?
    12·2 answers
  • In general, life needs to maintain a pH level between____.<br> 0)1-4<br> 0)5-8<br> 0)9-14
    10·1 answer
  • An example of natural selection is the tail of a male peacock. The females of the species choose mates based on the colors of th
    7·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The process in which the floors of a building collapse on one another is known as
    6·1 answer
  • Help please........ ​
    8·1 answer
  • Most plants have different colors in the fall because ________.
    8·1 answer
  • The heart rate increases during exercise. This increase in heart rate increases blood flow to the muscles. Explain, as fully as
    5·1 answer
  • How does the aorta compare in size to the other blood vessels near it?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!