1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delicious77 [7]
3 years ago
6

What makes one person's DNA different from another person?

Biology
1 answer:
guapka [62]3 years ago
7 0
Everyone's DNA<span> is </span>different<span> because everyone gets a random mix of the genes  The variation between people is </span>what makes us<span> individuals</span>
You might be interested in
How does evolution form new species? What happens to the other species?
Elena L [17]
Gene mutations provide new traits, those that are useful evolve and strive into new species'. Those that are not so useful, eventually die off
6 0
3 years ago
What is a photosystem?
Ostrovityanka [42]

Answer:

Photosystems are functional and structural units of protein complexes involved in photosynthesis. Together they carry out the primary photochemistry of photosynthesis: the absorption of light and the transfer of energy and electrons.

Explanation:

i tink this is helpful dor you

6 0
3 years ago
Read 2 more answers
true or false? sexual reproduction relies on meiosis instead of mitosis because only meiosis produces diploid sex cells.
Irina-Kira [14]
The answer is false. You're Welcome :)
6 0
3 years ago
Tiktaalik is an example of a transitional form linking __________ to ancestral __________.
Sergio [31]

Answer:

amphibians, fish

Explanation:

tiktaalik possessed a combination of fish-like features and amphibian-like features.

3 0
3 years ago
Why is musculocutaneous nerve missed with infraclavicular block?
larisa86 [58]

The musculocutaneous nerve is blocked d/t to the cords being blocked. There are type of surgeries may an infraclavicular brachial plexus block be used for forearm, arm, and hand.  There is  an increased/decreased risk of uncontrollable bleeding with the infraclavicular approach, there is an increased risk of haemorrhaging if the subclavian artery is punctured d/t inability to apply pressure to tamponade the bleeding. 

3 0
3 years ago
Other questions:
  • Does cell respiration occur in the plastids ?
    9·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • Arthur is testing how well various types of disinfectants can kill E. coli bacteria. He starts with a Petri dish that is covered
    15·1 answer
  • Which statement is true about stromatolites?
    15·2 answers
  • Which element is essential to making up all organic molecules?
    7·1 answer
  • What would happen if a c were inserted between the first and second codons
    6·1 answer
  • Which of the following processes occurs during sexual reproduction?
    9·2 answers
  • URGANT HELP!!!
    10·1 answer
  • Which of the organisms in the food web above could be classified as a secondary consumer?
    11·2 answers
  • Which of the following is NOT a way that models can be useful?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!