1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klemol [59]
2 years ago
9

What is the funtion of tRNA?

Biology
2 answers:
Readme [11.4K]2 years ago
6 0

Answer:

To bring amino acids to the ribosomes to be assembled into proteins

Explanation:

Transfer RNA or tRNA is a ribonucleoprotein which serves the purpose of chaperoning amino acids from the cytoplasm of the cell to the site of protein synthesis.

g100num [7]2 years ago
5 0

Answer:

D. to bring amino acids to the ribosomes to be assembled into proteins

Explanation:

You might be interested in
Which of the following terms is/are associated with the body’s capacity to produce ATP aerobically
Sav [38]
Oxygen consumptionIs your answer
4 0
3 years ago
What happens during the process of glycolysis?
maksim [4K]

Answer:

Glycolysis is the process in which one glucose molecule is broken down to form two molecules of pyruvic acid (also called pyruvate). ... Thus, four ATP molecules are synthesized and two ATP molecules are used during glycolysis, for a net gain of two ATP molecules. hope this answerssss u

7 0
2 years ago
Read 2 more answers
Describe the cycling of carbon in the carbon cycle as it passes through the living and non-living components of the ecosystem.
slamgirl [31]

Answer:

The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again. Most carbon is stored in rocks and sediments, while the rest is stored in the ocean, atmosphere, and living organisms.

Explanation:

6 0
2 years ago
Read 2 more answers
Plz help! Zoom in to see better!
uranmaximum [27]
Epistemology comes from Greek “episteme” meaning knowledge.... do the answer is epistemology

Good luck! Hope this is right and helped!!

I see another blank but don’t see a number to fulfill it so if you could tell me where to look I would be more than happy to help ;)
7 0
3 years ago
Both human beings and snakes have backbones,but snakes can perform more flexible movements than human beings.Why?
Mademuasel [1]

Bones of snakes are very loosely fused together like in humans. Hence these bones can move individually allowing the snakes to be really flexible. The ribs of snakes do not join like those of humans but instead, have free ends and do not have a sternum.

6 0
3 years ago
Other questions:
  • Michele believes she cannot lose weight because she has a slow metabolism. Of the research she has done on the subject, which wo
    10·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • After the DNA zips itself back up into a double helix, what does the mRNA do
    10·1 answer
  • What is contamination?
    13·1 answer
  • Eukaryotic cells contain many membrane-enclosed structures not found in prokaryotic cells. which cell structures are enclosed by
    8·1 answer
  • 2. What happened to the green active site of the protein in the mutated CFTR protein
    9·1 answer
  • Which foods would have the following nutrient test results?
    5·1 answer
  • Which measurement do geologists use to find the absolute age of once-living things?
    7·2 answers
  • Manganese-52 has a half-life of 6 days. How many days would a scientist have to wait for the radioactivity to be 12.5% the start
    11·2 answers
  • You are playing volleyball with your friends. You hear your setter call your name, you sense acceleration as you jump, you feel
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!