I believe A translates to U, T transtates to A, G translates to C, and C traslates to G.
<span> ATGCGCTGCACGTGCACGTTTACGCGACGTGCACGTGCAA
</span>
mRNA
UACGCGACGUGCACGUGCAAAUGCGCUGCACGUGCACGUU
Cat (Australia); lots of cats became feral and they reproduce very fast. They became the apex predator and the native species have no defense system for them, so the cats brought tens of species on the verge of extinction (mainly placental mammals).
Fox (Australia); became an apex predator in the lack of competition, and damages the populations of native small placental mammals.
Hair (Australia); reproduces much quicker than the native species of mammals, increased significantly in numbers, and out competes the native species for the food sources.
African bee (the Americas); much more aggressive and stronger than the native bees and systematically kills their populations.
Grey squirrel (Britain); reproduces quicker than the red squirrel, is bigger, and out competes for food, brought it on the verge of extinction.
It just got blowed or you can say get mixed in the air around you. You can see tiny pieces of ash while buring paper or wood. And that's exactly your answer.
Answer:
3
Explanation:
Vaccines contain a weakened form of the virus so that your body learns how to kill it. If you were to ever get the "real" virus, your body is able to recognize the virus and remember how to kill it much faster than if it was exposed to it for the first time.