Answer:
According to the number of sequence on DNA there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.
Explanation:
DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-
GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-
GAG UUU AUC CCC AAC UUG GCA UAA GGU AGG-
Glutamine, Phenylalanine, Isoleusine, Proline, Asparagine , Leucine, Alanine, stop codon. As ribosome reach on stop codon protein synthesis stopped and process aborted.
The dependent variable is on the Y axis and independent variable is on the X axis.
It seems that you have missed the necessary options for this statement to be complete, but anyway, here is the correct answer. The first of the two undeniable facts is that any localized population of a species has the potential to produce far more offspring than the local environment can support. this fact is important to understanding evolution because it means that <span>the population will ultimately overwhelm its environment, causing the environment to collapse. Hope this answer helps.</span>
<span>The hydrologic, rock, and tectonic cycles are all interconnected. In the rock cycle, water moves regolith during erosion, and the tectonic cycle resurfaces rock through uplifting.The hydrologic, rock, and tectonic cycles are powered by the sun and by the Earth’s interior, the core.</span>
Free energy is a composite function that balances the influence of energy vs. entropy.
