1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
3 years ago
12

Which of the following is NOT a way in which humans increase biodiversity?

Biology
2 answers:
kolbaska11 [484]3 years ago
8 0
Introduction of invasive species



In this case you would be introducing something harmful to the environment which would decrease biodiversity instead of increasing it.
Allisa [31]3 years ago
5 0

Answer:

restoration of local communities

You might be interested in
In the biology lab you have just finished a dissection, you should do all of the following EXCEPT
arlik [135]
Wrap your specimen in the original wrapping and give it your instruct to dispose of
7 0
3 years ago
Read 2 more answers
Dandelions can produce seeds by both asexual and sexual
LUCKY_DIMON [66]

Answer:

only appear in veg plants

Explanation:

Unlike other forms of asexual reproduction in plants such as vegetative plant propagation via cuttings, apomixis is asexual reproduction via seeds. In the case of most dandelions (i.e., Taraxacum officinale), the embryo in the seed forms without meiosis, thus the offsping are genetically identical to the parent.

6 0
3 years ago
Roles in aquaculture​
Anika [276]
It’s a place that has lots of fish and they catch a lot fish there.
4 0
3 years ago
Which one of the following answers has clear ectoplasm, pseudopodium, nucleus, contractile vacuole, cell membrane, and granular
kati45 [8]
B . Animalia is the answer for your answer
3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Elements in carbon dioxide
    7·1 answer
  • What is Type O blood's Genotype????????
    7·2 answers
  • How do land Animals prevent water loss?
    12·1 answer
  • In some chickens, the gene for feather color is controlled by codominance. The allele for black is B and the allele for white is
    8·1 answer
  • Which statement is an example of a scientific theory?
    14·2 answers
  • (ASAP) explain why MRSA strains are difficult to treat. 3 marks
    10·2 answers
  • Evidence of climate changes and conditions that affected early societies are gathered from _____. written records ice core sampl
    12·1 answer
  • In a multicellular organism what accounts for the differences between different types of cells
    11·1 answer
  • Which of the following is true of artificial selection?
    8·1 answer
  • Explain in your own words why there is uncertainty in science. What can scientists do to reduce uncertainty in science?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!