1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tresset [83]
3 years ago
5

Upgrades required by a Federal, State, Local, Territorial, or Tribal government are eligible if the code or standard:

Geography
1 answer:
Julli [10]3 years ago
4 0

Answer:

These updates are only eligible if the code or standard has the required type of restore, is appropriate for the type of restore, prevents disasters during installation, is a legal requirement, is uniform, and is enforced during the given period.

Explanation:

The question above refers to the mobilization of federal, state, local, territorial and tribal governments to solve structural problems created by natural disasters, terrorist attacks or any other human action that could harm the physical structure of the region. In situations like this, governments can look for economic and professional help to solve these problems. This assistance is provided by FEMA (Federal Emergency Management Agency) which analyzes assistance requests by preparing documents that present codes that specify the type of problem and help needed. These codes are only eligible if: they have the type of restoration required, they are appropriate for the type of restoration, they prevent disasters during installation, they are legal requirements, they are uniform, and they are applied for the specified period.

You might be interested in
Which of the following usually results in large scale earthquakes? *
Anarel [89]

Answer:

Convergent Boundaries

Explanation:

6 0
3 years ago
_________ water is a term used to describe water that is safe to drink. What is it?
cupoosta [38]
I would like to guess the answer is distilled water but I'm not positive
3 0
3 years ago
Read 2 more answers
Which of the following statements best characterizes the Congo Free State under the rule of King Leopold II?
horrorfan [7]

Answer:

C

Explanation:

The king treated it as his property.

6 0
3 years ago
Read 2 more answers
What waterway is the most significant to the regions due to its vast resources?
Advocard [28]
~Hello there! ^_^

Your question: What waterway is the most significant to the regions due to its vast resources..?

Your answer: Tigris River is the water way that is the most significant to the regions to its vast resources.

The answer is option C.

Hope this helps~






6 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • How did east Africa’s location help it to become major international trading center
    9·1 answer
  • More than half of the bright stars we see in our galaxy are actually star systems
    13·2 answers
  • PLEASE HELP!!!!!!!!!!
    13·1 answer
  • Why is earth a goldilocks planet?
    13·1 answer
  • Explain why tropical rain forests contain a large variety of plants and animals.
    10·2 answers
  • Today, much of ____________ is centered around the production of animals and animal products and the production of feed for thos
    6·2 answers
  • Though cultures always blend, combine, and grow together, every culture seeks to preserve its traditions. What efforts have been
    11·1 answer
  • Which phrase describes organisms that formed index fossils?
    9·1 answer
  • What is one way in which an ecosystem can affect a culture
    12·1 answer
  • How would frequent earthquakes and violent storms affect people’s daily lives?.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!