Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
1- Pyloric sphincter
2-Duodenum
3- Bile duct
4-Pancreatic duct
5-Esophagus
6-Lower esophageal sphincter
7-Fundus of stomach
8- Cardia
9-Body of stomach
10-Pyloric part
The <span>esophagus(5) connects to the stomach.</span>
<span> The food passes,from the pharynx, to the esophagus, to the stomach. This process is aided by peristaltic movements done by esophagus muscles.
This organ contains two sphincters:</span><span>the upper and the lower esophageal sphincter.
</span>The stomach is divided into four parts:
<span><span>1-The cardia (8) - this part is connected to the esophagus and its where the epithelium changes from stratified squamous to columnar.
In this region is the lower esophageal sphincter (6).
</span>2--The fundus(7)- It's formed by the upper curvature of the stomach.
3- the body(9)- is the main part; and the biggest
4-The pylorus/</span><span> Pyloric part (10) - is the lower region. This part is connected to the small intestine, the duodenum. In this region there is a </span>
strong ring of muscle called the (<span>1) Pyloric sphincter.
In the first part of the duodenum there is a connection with a duct that comes from the pancreas -4-</span>Pancreatic duct .
There is another duct that ends in the duodenum called- <span>Bile duct, that caries bile to digest fats.</span>
Sunlight
solar energy
water
Answer:
D. It is non-living
Explanation:
If something is not made of cells, it cannot be alive.
The answer to this question may be the second one," Mitosis produces two genetically identical daughter cells but meiosis produces four genetically different daughter cells."
