1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svet_ta [14]
2 years ago
9

2. Which of the following cloud types would most likely produce precipitation?

Biology
1 answer:
Licemer1 [7]2 years ago
4 0
3rd option. Cumulonimbus

Cumulonimbus clouds are associated with extreme weather such as heavy torrential downpours, hail storms, lightning and even tornadoes.
Hope this helps;)
You might be interested in
Water-storing plants and deeply rooted shrubs are plants that characterize?
Nady [450]

Desert vegetation or xerophytes includes bushes with deep roots and plants that store water.

Another name for desert plant:

A plant species known as a xerophyte has evolved to live in environments with little fluid water, like a desert or an area surrounded by ice or frost in the Mountains or the Polar regions. Cacti, pineapples, and various Gymnosperm species are a few well-known instances of xerophytes.

  • Xerophytes have different adaptations to their morphological characters (morphology) and basic physiological functions (physiology) that allow them to store significant amounts of water and save it during dry seasons. During prolonged periods of severe dehydration or evaporation of their organs, some creatures can live, and at those times, their biochemical function may cease. Xeromorphic flora has such biological and morphological modifications.

Learn more about xerophyte here:

brainly.com/question/4782897

#SPJ4

6 0
2 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Which DNA strand is complementary to TGTAGCTGCGCGT?
Zepler [3.9K]

Answer:

ACATCGACGCGCA

Explanation:

7 0
2 years ago
Read 2 more answers
Which of the following qualifies as point-source pollution?
Lynna [10]

Answer:

the answer is b

Explanation:

6 0
3 years ago
What 3 things make a frog an amphibian
Maurinko [17]
They have a back bone
They are cold-blooded
Breathes through skin
(extras)
they go though metamorphosis
and they hatch from eggs! <span />
6 0
2 years ago
Read 2 more answers
Other questions:
  • Whats the difference between solute and a solvent
    10·1 answer
  • What evidence supports the law of conservation of energy?
    10·2 answers
  • What are the 8 cranial bones?
    15·2 answers
  • Fruit flies are commonly used in genetic investigations that focus on traits passed from parents to offspring over several gener
    15·1 answer
  • Svetlana loves plants and animals. She wants to study how they live in their environments. Svetlana will most likely become a(n)
    15·2 answers
  • Why are muscle cells also called muscle fibers?
    15·1 answer
  • The following would be a cognitive symptom of schizophrenia.
    7·2 answers
  • In order to change C to B to A, one would need to:
    10·1 answer
  • Diagrams,tables,and graphs are used by scientists mainly to
    12·2 answers
  • What is the volume of a cube with a side length of 3 centimeters?(1 point)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!