No idea but hopefully this cheers you up!
Answer:
B. They sold 120 student and 30 adult tickets.
Explanation:
120 x 12 = 1,440
30 x 20 = 600
1,440 + 600 = 2,040.
Answer:
D
Explanation:
The simple answer is the electrons in the outermost energy level.
Hydrogen has 1 electron in the outermost energy level.
Magnesium has 2 so this tells you that magnesium has a charge of 2
Oxygen has 6 oxygen has a charge of - 2
Fluorine has 7
For most elements, the electrons in the most outer ring determine the valence of the element.
Notice that the non metals work differently than the metals. Mg may have a charge of 2 and that is the number of electrons in the valence right.
Oxygen is a non metal it has a charge of - 2. It gets 6 electrons by subtracting the number of its charge from 8.
Answer: Diatoms.
Explanation:
Diatoms are single celled group of algae that are found in aquatic habitat both freshwater and marine habitat. The are the most important primary produce in the marine habitat. They are photosynthetic I .e they have chlorophyll which help them to trap light energy from sunlight and uses carbon dioxide and water to produce food. They produce food with the process of photosynthesis.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
