Answer:
The correct answer is - electron transport system.
Explanation:
There are 3 main stages of cellular respiration (aerobic) that are Glycolysis, the Kreb's Cycle and the ETS or Electron Transport Chain. The formation of energy in ATPare as follows:
Glycolysis - glucose > 2 Pyretic Acid Molecules =>2 ATP and Hydrogen
The Krebs Cycle - Citric Acid (a derivative of Pyruvic Acid) > 2 ATP in 4 cycles and Hydrogen, carbon dioxide and water.
The Electron Transport Chain > electron carrying Hydrogens > releases the energy as 4 ATP and water
Thus, the correct answer is - The Electron Transport Chain is the stage that produces most of the ATP during cellular respiration.
The words for the descriptions are food chain, trophic level, energy pyramid, high diversity, low diversity, etc. respectively.
<h3>Ecology</h3>
- The feeding relationship that exists among organisms is termed the food chain.
- Each step in the transfer of energy and matter in a community is termed the trophic level.
- A community or group of living organisms that live in and interact with each other in a specific environment is termed an ecosystem.
- A diagram that compares the energy used by producers, primary consumers, and other trophic levels is known as the energy pyramid.
- An ecosystem with a high number of species is said to be of high diversity.
- An ecosystem with a few prominent species and a low number of other species is said to be of low diversity.
- Organisms that feed on and break down organic matter are said to be decomposers.
- Organisms that can make their own food in the ecosystem are termed, producers.
- Animals that feed on flesh are called carnivores.
- A system of interlocking and interdependent food chains is called a food web.
More on ecology can be found here: brainly.com/question/13046612
#SPJ1
The main term of reference in the index is Aneurysm
Extra cranial carotid artery aneurysms ruptures when the blood clots are formed in them. The term aneurysms is a disease that is happening due to the weakness in the wall of artery. The weakened arteries widens out or swells.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
