1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serggg [28]
3 years ago
15

NEED HELP ASAP WILL GIVE BRAINLIST

Biology
1 answer:
vaieri [72.5K]3 years ago
3 0

Answer:

The answer could be climate

Explanation:

It could be climate because it is describing what the desert is like and the seems to be the word that best fits the sentence.

You might be interested in
Listen
Artyom0805 [142]

Answer:

I Think this

directly provide leaf cells with the water involved in photosynthesis

Explanation:

8 0
4 years ago
Which of the following does NOT affect the flow of groundwater through an aquifer ? a. porosity C. gradient b . chemical weather
creativ13 [48]

Answer:

b . chemical weathering

Explanation:

Chemical weathering is not affected the flow of groundwater through an aquifer but affect by the porosity and permeability. The rate of groundwater flow is controlled by two properties of the rock which are porosity and permeability. Porosity is the percentage of void space in a rock while on the other hand, Permeability is the quality of being permeable means able to be penetrated or passed through by a liquid or gas.

4 0
3 years ago
"Evolution is like a climb up a ladder of progress; organisms are always getting better." O True O False​
Romashka-Z-Leto [24]

Answer: True because In biology, evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. The theory of evolution is based on the idea that all species? are related and gradually change over time.

6 0
3 years ago
Carbon atoms have four electrons in their outer shell. This means that a single carbon atom can form up to _______ bonds with ot
Levart [38]

Answer:

four

Explanation:

Carbon atoms have four electrons in their outer shell. So, it exhibits tetravalency & thus, a single carbon atom can form a maximum of four (4) bonds with other atoms

4 0
4 years ago
He human eye is poorly suited to night vision, suffering impairments in __________.
REY [17]

The human eye is grief in damage of in-depth perception, color recognition, and peripheral vision. Judging speed and distance based on visual evidence is also more difficult in the dark.  In addition, the darkness of night, and even the dimness of dusk and dawn.  

3 0
4 years ago
Read 2 more answers
Other questions:
  • How many alleles are there for the four main types of human blood?
    6·2 answers
  • The chemical process for respiration
    5·1 answer
  • The net result of a single round of glycolysis is the formation
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • (1 pt) Why is DNA called the blueprint for life? A. It has the code to make carbohydrates. B. It stands for Director of New Acti
    9·2 answers
  • if a homozygous dominant parent and a heterozygous parent are crossed, what percentage of the offspring are expected to heterozy
    9·1 answer
  • a population of chimpanzees was separated when the forest that they lived in had a section cut down and a town was built. After
    11·2 answers
  • In what age did the T Rex exist
    15·2 answers
  • PLEASE HELP!! ASAP.
    15·1 answer
  • What is the major difference between the saturated and unsaturated zones?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!