In which of the vegetation is farming difficult?

1 answer:

8 0

<span>Densely covered areas like rainforests are poor areas for agriculture. This is because of the soil composition of the land where soils are usually acidic and they contain low levels of minerals and other nutrients necessary for mass production of crops in agriculture. This type of vegetation has a very unique form of nutrient cycle that can’t be good for crops.</span>

You might be interested in

Tanya is training a turtle for a turtle race. For every 1/6 of an hour that the turtle is crawling he can travel 1/24 of a mile.

frozen [14]

The rate at which Tanya's turtle travels is 0.25mi/hr

This question is from a topic in mathematics called Rate.

This is a ratio in which different terms in different units are compared against each other.

In this question, for every 1/6 of an hour, the turtle is crawling 1/24 of mile.

Data given;

1/24 miles in 1/6 hour

Let's express this mathematically

$1/24 mi = 1/6 hr\\x mi = 1 hr\\x = (\frac{1}{24})/(\frac{1}{6})\\x = 0.25mi$

What this calculation shows is that the turtle travels at 0.25mi/hr

The rate at which the turtle travels is 0.25 miles in an hour or 0.25mi/hr

Learn more about rate here;

brainly.com/question/11408596

4 0

3 years ago

How many americans over the age of 12 are estimated to be infected with the human papilloma virus?

11111nata11111 [884]

According to some research it is estimated that about 20% of americans of the age of 12 are infected with the human papilloma virus.

Hope it helped,

Happy homework/ study/ exam!

6 0

3 years ago

Scientists can identify the gene mutated in a bacterial auxotroph by transforming the cells with a genomic library in which frag

Nimfa-mama [501]

Answer: false

Explanation: this can only be true if the genes in the genomic library fragments have been identified and if the mutation is an SNP and not an inversion or deletion or insertion, whether they were cloned into plasmids or not.

8 0

2 years ago

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

Ierofanga [76]

<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)

6 0

3 years ago

What is the role of synovial fluid in synovial cavities?

andreyandreev [35.5K]

Answer:

B.Lubricating cartilage at joints

8 0

3 years ago