1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pantera1 [17]
3 years ago
5

How/why does cancer kill?

Biology
1 answer:
Kobotan [32]3 years ago
5 0

Explanation:

Cancer can kill when it invades essential organs, like your liver, lungs, or brain, and stops them from functioning properly. These complications could be due to primary cancer that starts in an essential organ, such as brain cancer. Or it could be cancer that has metastasized from one area to another.

You might be interested in
Proteins and nucleic acids both play vital roles in the structure and function of cells.
Eva8 [605]

Answer:

Part A: Proteins are made from amino acid monomers. There are 20 different types of amino acids which make up all the proteins of the body. The amino acids are made up of a carbon atom which is joined to an amino group, a carboxyl group and a variant group, known as R. Nucleic acids are made up of 5 carbon sugar, phosphate group and nitrogenous bases.  Hence, nucleic acids are made up of nucleotides.

Part B: Protiens are important molecule which carry out various functions of the body. They are involved in regulation of various body process. Some proteins are involved in the transportation of various molecules. Other type of proteins are involved in various immune functions and hence protect the body. For example, antibodies are proteins which defend the body against pathogens.

Nucleic acids are involved in the storing and expressing of genetic information. They also direct the body for protein synthesis.

7 0
3 years ago
How do sedimentary rocks form on Earth’s surface?
erik [133]

Answer:

I am 95% sure its b, if not then it is c

5 0
3 years ago
Sugars provide the primary food source for plants. the leaves of a plant make sugar during the process of photosynthesis. Sugars
BartSMP [9]

Answer:

phloem

Explanation:

8 0
3 years ago
The lymphatic system is responsible for transporting what to the blood stream
GREYUIT [131]
Lymph nodes or plasma
3 0
3 years ago
Which of the following choices are all abiotic factors of a freshwater ecosystems?
LenaWriter [7]
I think can be water, light, temperature, nutrients


Hope help!
4 0
3 years ago
Other questions:
  • The presence of many large, highly branched purkinje cells in a sample of brain tissue indicates that it came from the
    8·1 answer
  • Mendel formulated his principles of inheritance based on _____. mendel formulated his principles of inheritance based on _____.
    15·1 answer
  • When cooling food, the temperature of the food must reach ___ within 2 hours and 41°f within an additional 4 hours?
    13·1 answer
  • A study has shown that Scotland's river otter population is increasing after falling
    6·1 answer
  • After graduation, you and 19 friends build a raft, sail to a deserted island, and start a new population, totally isolated from
    15·1 answer
  • Which explains the basis of the Biuret test?
    9·1 answer
  • Which of the following is FALSE regarding the DNA double helix?
    11·1 answer
  • Which of the following was a function of the wetlands in Florida?
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which part of the spleen is its primary site of immune function?.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!