1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
torisob [31]
3 years ago
13

The component(s) of india in which tensions continue to boil over border demarcation is

Biology
1 answer:
gregori [183]3 years ago
4 0
For the answer to the question above, I believe the answer is Jammu and Kashmir which is located in the Northern state of India. Located mostly in the Himalayan Mountains. It <span>shares borders with the states of Himachal Pradesh and Punjab to the south</span>
You might be interested in
Which of the following is the most likely do we observe it by a physiologist
vampirchik [111]
What controls what molecules pass in and out of a cell?
5 0
3 years ago
_: the rate at which electric charge passes a point in a circuit.
Inga [223]
C is the answer Current
7 0
2 years ago
Differentiate external and internal environment factors in influencing Gene expression​
Scilla [17]

Answer Internal and external environmental factors, like gender and temperature, influence gene expression. ... Similarly, drugs, chemicals, temperature, and light are among the external environmental factors that can determine which genes are turned on and off, thereby influencing the way an organism develops and functions.

Explanation:

3 0
3 years ago
Which of the following is a relatively new disease?
Anni [7]
The correct answer is D. Bird flu.

Polio and smallpox are very rare today as they were eradicated hundreds of years ago and TB has been around for maybe thousands of years. Bird f!u was discovered in 1957.
4 0
3 years ago
Oils produced by your skin fall under which category of macromolecules?
Zinaida [17]
They are liquid lipids..
(d)
4 0
3 years ago
Other questions:
  • A change that increases an organism's chances of survival is called a(n) _____.
    7·1 answer
  • What organisms are prokaryotic​
    12·1 answer
  • Which of the following is an example of a human disruption to the balance of nature?
    12·1 answer
  • A client who just has been diagnosed with primary open-angle glaucoma (poag) refuses therapy. the nurse reinforces that it is im
    13·1 answer
  • In which case would a scientist choose to use a dissecting microscope rather than a compound
    5·1 answer
  • Pls help! ill give brainliest to whoever answers all of them correctly H2O + O2. Which of these includes all of the reactants?
    6·1 answer
  • Haploid and diploid chromosome sets are common in both plants and animals, but plants frequently have additional sets of chromos
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Cell membrane meaning
    12·1 answer
  • Which region of the human alimentary tract has both the largest population of bacteria and the greatest species diversity
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!