Answer: D) constructive process
Explanation:
Deposition is the geological <u>process</u> in which sediments, soil and rocks are <u>added</u> to a landform or land mass. Wind, ice, water, and gravity transport previously weathered surface material, which, at the loss of enough kinetic energy in the fluid, is deposited, <u>building up</u> layers of sediment.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Igneous rocks are formed when the magma from an erupting volcano eventually cools this rock is extrusive- found on the earth's surface.
DNA to 8. the genetic blueprint for all cells
Nucleus to 5. acts as the "brain" of a cell
Connective cells to 9. tendons, blood, and fat are examples of these cells.
Epithelial tissues to 6. designed to regulate temperature, secrete lubricants, and protect the body from harmful substances.
Cytoplasm to 7. fluid like substance in a cell
Organelles to 3. structures that perform special functions within a cell
These are the only ones I know.
