1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zanzabum
2 years ago
11

One characteristic of all living organisms is that they have genetic information. What is the name of this genetic information a

nd why is it considered “universal”?
Biology
1 answer:
Aloiza [94]2 years ago
6 0

Answer:

344

Explanation:

34235

You might be interested in
I need help with this (#20)
tester [92]

Answer:

a Anaphase I

b Metaphase I

c Telophase I

d Anaphase II

e Prophase I

f Telophase II

Explanation:

Prophase I begins after the DNA has been duplicated, as shown in picture e. The chromosomes are condensed, and also visible, which is apparent in picture e.

The next stage is called Metaphase I, in which the pairs of homologous chromosomes align at The the centre of the cell and the spindle fibres attach, as shown in picture b.

The pairs of chromosomes are pulled apart to opposite poles of the cell by the spindle fibres., as shown in picture a. This stage is called Anaphase I.

Then, a process called Telophase I occurs, when the cell divides into two daughter cells. One of these cells is shown in picture c.

Picture d shows the stage Anaphase II, where the spindle has attached and the chromatids are pulled to the opposite poles of the cell.

The final picture left is picture f, which shows the daughter cell at the end of meiosis II, where the nuclear envelope is reforming, as in telophase II.

8 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
10 points for each answer, I'm not afraid to report. The graph is shown in the picture.
Neporo4naja [7]

Answer:

Location A

Explanation:

Coastal areas have milder temperatures since they are close to water and water retains heat better than land (it's harder to warm it up and harder to cool it down). Due to this property of water, the location with the least temperature fluctuation would be the answer. Location A has the smallest range between the highest and lowest annual temperatures, making A the best answer choice. I hope I helped and that it's not too late for you.

6 0
3 years ago
Una hipótesis sobre las drogas
sveta [45]

Answer:

Entre ellas la más destacada y elaborada es la Hipótesis de la Automedicación que propone que los trastornos por dependencia de drogas son el resultado de la existencia de una alteración biológica

Explanation:

5 0
2 years ago
Which statement describes the geologic process that is most likely responsible for the formation of these mountains
forsale [732]

Answer:

They are along a plate boundary in which plates are currently converging, causing uplift and steep slopes

6 0
3 years ago
Other questions:
  • Where in the body does fertilization usually occur
    10·2 answers
  • When we are born, we have about how many brain cells?
    9·2 answers
  • Which jet stream affects weather in Siberia?
    10·1 answer
  • Birth defects can be caused by:
    7·2 answers
  • Which of the following is a reason why early living organisms on Earth could not have survived on the surface? 1. the lack of an
    9·1 answer
  • Thirty-five-year-old Lucy needs to have her blood taken. She is so distraught by this that she must mentally prepare herself for
    14·1 answer
  • How many protons does oxygen (O) have?<br> a) 2<br> b) 4<br> c) 8<br> d) 16<br> e) 32
    13·1 answer
  • If no subscript is written, only ______atom of the element is in the chemical formula
    8·1 answer
  • Please help me with this but also take your time
    6·2 answers
  • Consider this animal cell.<br> A<br> B<br> Н.<br> с<br> D<br> E<br> F.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!