1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vanyuwa [196]
3 years ago
6

Most periods in the geologic time scale are named for

Geography
2 answers:
Alenkasestr [34]3 years ago
8 0

Explanation:

The names of the eras in the Phanerozoic eon (the eon of visible life) are the Cenozoic ("recent life"), Mesozoic ("middle life") and Paleozoic ("ancient life"). The further subdivision of the eras into 12 "periods" is based on identifiable but less profound changes in life-forms.

It subdivides all time into named units of abstract time called—in descending order of duration—eons, eras, periods, epochs, and ages. The enumeration of those geologic time units is based on stratigraphy, which is the correlation and classification of rock strata

Naddika [18.5K]3 years ago
6 0

Answer:

The names of the eras in the Phanerozoic eon (the eon of visible life) are the Cenozoic ("recent life"), Mesozoic ("middle life") and Paleozoic ("ancient life"). The further subdivision of the eras into 12 "periods" is based on identifiable but less profound changes in life-forms.

You might be interested in
Kahalagahan ng economical
Kay [80]
Yess Could you explain more and I’ll get back to ya
7 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Why are the N, S, E, and W designations often omitted from coordinates on U.S. topographic maps?
Karolina [17]
In a Topographic map,  here are the programming values of each of that navgations:

N = positive value to the latitude
S= Negative value to the Latitude
W = Positive value to the longitude
E = Negative value to the longitude

Most programmers that work to create the topographic map choose to simply ommit the <span>N,S,W,&E</span> because it will save them a lot of time from having to type in a minus sign before most of their longitude values in code writing.<span>
</span>
7 0
3 years ago
Is there life in other planets?​
ahrayia [7]

Earth is the only planet that habours life.

So the answer to the question would probably be no.

3 0
2 years ago
Currently, about 10% of Earth is covered with ice year-round. If this ice melts, what could happen to Earth's temperature?
Advocard [28]
If the ice melts, the temperature could increase.

Hope this answer helps, If you have any other questions just feel free to ask :)
3 0
3 years ago
Other questions:
  • Is this correct?!!? :D
    5·1 answer
  • What is a fraction in the crust called when land moves up, down, or sideways?                                                   
    11·1 answer
  • Metamorphic rocks that have a banded appearance due to the alignment of minerals are called
    13·2 answers
  • Soil can best be described as the?
    8·1 answer
  • Which one of the following accurately describes the force of gravity?
    10·1 answer
  • What is our spanish speaking neighbor to the south
    12·2 answers
  • Rainfall in the deserts Group of answer choices Lasts for many days when it comes Is incapable of moving much material Is usuall
    5·1 answer
  • Which of the following is a negative affect of that Aswan High Dam?<br><br><br> AWNSER PROOF!!!!
    9·2 answers
  • The expression 8y+9 made up___term a.one b.two c.three d.four​
    5·1 answer
  • Which answer choice below best explains some of the responsibilities and powers that can be found in the executive branch of gov
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!