1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
7

Which part of DNA is the actual genetic code? *

Biology
2 answers:
OLga [1]3 years ago
7 0
Stored on one of the two strands of a DNA molecules as a linear, non-overlapping sequence of the nitrogenous bases Adenine (A), Guanine (G), Cytosine (C) and Thymine (T). These are the "alphabet" of letters that are used to write the "code words".
emmasim [6.3K]3 years ago
5 0
Adenine, Guanine, Cytosine, Thymine?
You might be interested in
What is representative sample
Rina8888 [55]

Answer: A group that closet matches characteristics

Explanation:

A representative sample is a group that closely matches the characteristics of its population as a whole. In other words, the sample is a fairly accurate reflection of the population from which the sample is drawn.

4 0
4 years ago
GIVING BRAINLIEST!
Elena-2011 [213]
You WILL lose thermal energy cuz heat will always flow from warmer to cooler.

Hope it helps!
5 0
4 years ago
All living things are made of ________ like carbon, nitrogen, and oxygen
MrRissso [65]

Answer:

Water

Explanation: I think this is the answer if I am wrong please tell me thank you.

3 0
3 years ago
1) Bones function as levers for the muscles to provide movement of the body. What is the function of a tendon in the skeletal sy
notsponge [240]

Answer:

b

Explanation:

5 0
3 years ago
Read 2 more answers
3. What things does your body do automatically to cool down or warm up?
NemiM [27]

Answer:

For your body to cool down one method is to sweat.

Explanation: Your sweat glands release sweat, which cools your skin as it evaporates. This helps lower your internal temperature

7 0
3 years ago
Read 2 more answers
Other questions:
  • Ben uses a reusable storage bag to carry snacks to school. Debbie uses a similar bag to store pencils so her book bag doesn't ge
    10·1 answer
  • In one kind of abnormal chromosome inheritance called down syndrome, a child has three copies of
    10·1 answer
  • Which is a role of Eubacteria in living systems?
    11·2 answers
  • Which statement describes an effect of natural
    7·1 answer
  • 5.2 learning the key term answer
    12·1 answer
  • Multicellular, heterotrophic organisms that lack cell walls is A) Plants
    9·2 answers
  • 1. The overall shape of a plant cell is most directly related to which of its parts?
    7·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • 4. What properties do compounds have with strong attractive forces between their atoms?
    6·1 answer
  • Can someone help me out with this one, if you do ill give you brainly and give extra points! Thank you :) I’m giving 100 points
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!