1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ludmilka [50]
3 years ago
15

This is my test please help me

Geography
1 answer:
vredina [299]3 years ago
4 0

Answer:

Germany

Explanation:

In the Paris Peace Conference, Germany was one of the countries that wasn't included.

You might be interested in
The story behind the ____________ genocide begins with colonialism. The split between Hutus and Tutsis arose not as a result of
Elis [28]

Answer:

Rwandan

Explanation:

8 0
3 years ago
Read 2 more answers
Which country is most culturally similar to Australia
Igoryamba

Answer:No matter how you tinker with the weights, Canada and New Zealand end up being among the countries most similar to Australia. Switzerland and the UK, too, are quite similar to us

Explanation:

4 0
3 years ago
Read 2 more answers
18.(1) What is the main relative motion between the North American Plate and the Eurasian Plate? a. Convective b. Convergent C.
ElenaW [278]
ANSWER:
D. Divergent
6 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
This is astronomy and This is 20 points
Andreas93 [3]

Answer:

If you jumped into the black hole feet first, the gravitational force on your toes would be much stronger than that pulling on your head. Each bit of your body would also be elongated in a slightly different direction. You would literally end up looking like a piece of spaghetti.

5 0
3 years ago
Other questions:
  • Which of the following is not a main use of fuel
    7·1 answer
  • Why did iron and steel decline in South Wales??
    5·1 answer
  • How has the movement of continents caused Earth's climate to change?
    9·1 answer
  • What are some reasons to consider San Francisco and Hong Kong as part of the same region? Check all that apply. O A. National bo
    11·1 answer
  • As a result of the Louisiana Purchase
    5·2 answers
  • Why did the indigenous population of Central America decline with the arrival of Europeans?
    8·1 answer
  • What states voted for the republican presidential candidate in 1996, 2000, 2004, and 2008?
    13·1 answer
  • Most of the cattle ranches in Brazil are located
    5·2 answers
  • What accounts for most of the population growth of Europe?
    6·2 answers
  • cloud droplets form around small particles in the atmosphere. describe how the hurricane clouds formed from water vapor. include
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!