1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
german
3 years ago
10

Predator populations decrease if the number of prey increases. true or false

Biology
1 answer:
Vikki [24]3 years ago
6 0
False

Because the predators would have more food if the prey increased
You might be interested in
Organisms can be classified in the same species by morphology and ?
slamgirl [31]

Every species is assigned a standard two-part name of genus and species. ... Organisms are grouped into species partly according to their morphological, or external, similarities, but more important in classifying sexually reproducing organisms is the organisms' ability to successfully interbreed.

5 0
3 years ago
Read 2 more answers
An unknown substance kept in a sealed container at STP had a density of 808 kg/m3. When the container was opened and the substan
Marat540 [252]

Answer:

I think its liquid to gas. :)

7 0
3 years ago
Binary ionic compounds are named in what pattern
Andre45 [30]
Binary ionic compounds are named in the pattern of metal, then nonmetal.

I hoped this helped.
3 0
3 years ago
The nurse should use which needle when administering a nonviscous solution by the intramuscular (im) route for an adult?
Greeley [361]
<span>The most appropriate choice of needle for someone of this size is a 1.5 in, 22 gauge needle. It is important for the needle to be 22 gauge so that it is an appropriate thickness to be injected into the muscle tissue.</span>
5 0
3 years ago
Read 2 more answers
andy extracted a component of blood and onserved it under the microscope. He found out that the conponent contained cells with n
malfutka [58]

Answer:

WBC.

Explanation:

WBC have cells, hence the name White Blood CELLS. They also contain a nucleus.

3 0
2 years ago
Other questions:
  • Genetic discord are diseases or conditions caused by abnormal or mutations in our genes.
    9·2 answers
  • Jimmy has always been told that if you have chicken pox once, you will not get the disease again. He had chicken pox when he was
    11·2 answers
  • Movement of the chromosomes during anaphase would be most affected by a drug that prevents mitosis and cell division. What is th
    10·1 answer
  • Which of Earth’s spheres includes the oceans, groundwater, lakes, and glaciers. A) Geosphere B) Hydrosphere C) Biosphere D) Atmo
    14·1 answer
  • Answer the lab question, “What is the effect of the inheritance of one trait on the inheritance of a second trait?” with a hypot
    11·2 answers
  • Photosynthesis iPhotosynthesis is an example of
    12·1 answer
  • What are the correct answers?
    14·1 answer
  • Muchos medicamentos son productos
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • In general, the higher the intensity of exercise, the greater the contribution of:______
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!