1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goblinko [34]
3 years ago
15

Write the code for RNA from this DNA STRAND : AAAAAATTTTTTCCCGGGGTTTATATATC

Biology
1 answer:
Cloud [144]3 years ago
4 0

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

You might be interested in
Active transport move molecules from a?
AVprozaik [17]
Is there supposed to be a picture attached to this..?
8 0
3 years ago
Read 2 more answers
What do all prokaryotes and eukaryotes have in common ?
EastWind [94]

Answer:

C. The cells that make them up each contain genetic information.

Explanation:

A and B are not the answer because prokaryotes are unicellular organisms while eukaryotes are multicellular organisms. D is not the answer because prokaryotes do not have a nucleus, leaving the DNA floating in the cytoplasm.

7 0
3 years ago
Read 2 more answers
In corn, red kernel color (R) is dominant to yellow (r) and smooth kernel texture (W) is dominant to wrinkled (w).
Wewaii [24]

Answer:

a. df =  3, chi-square = 1.7333, p value = 7.815

b. we fail to reject null hypothesis

c. it is independent of kernel texture

Explanation:

h0; there is independence

h1; no independence

9:3:3:1 this is the phenotypic ratio

9+3+3+1 = 16

330 red smooth  + 97 red wrinkled  + 101 yellow smooth  + 32 yellow wrinkled

total observed = 560

1. the degree of freedom = n-1

n =4, 4-1 = 3

to get the chi square computation

(O-E)²/E

expected value for red smooth,

9/16 x 560 = 315

chisquare = (330-315)²/315 = 0.7143

expected for red wrinkled

3/16*560 = 105

chisquare = (97-105)²/105 = 0.6095

expected for yellow smooth

3/16*560 = 105

chisquare = (101-105)²/105 = 0.1524

expected for yelow wrinkled

1/16 * 560 = 35

chisquare = (32-35)²/35 = 0.2571

total chisquare = 0.7143+0.6095+0.1524+0.2571

= 1.7333

with probability = 0.05, df = 3, the value of the chi square from x² table = 7.815

1.7333 < 7.815

so  we fail to reject the null

c. we conclude that kernel color is independent of kernel texture

7 0
3 years ago
There is a legend about an autopsy having been performed on a space alien in New Mexico, many decades ago. Assuming that this al
BartSMP [9]

Answer:

In the given case, the brain of the alien would be showing an enlarged region with surface grooves and folds. It is nothing but the cerebral cortex and mainly the neocortex. As the name suggests that it is the latest addition to the brain and is regarded to be originated by the process of evolution.  

It is the main region of extraordinary cognitive tendencies like reasoning, thinking, analysis, and other things. As mentioned in the question, that alien is trained like astronauts on the Earth, thus, this neocortex would be certainly found in the brain of the alien.  

4 0
3 years ago
An individual is infected withMycobacterium tuberculosis. The bacteria infect macrophages in the lungs, where it survives and re
11Alexandr11 [23.1K]

<u>Autophagy</u> is the mechanism which will be used by the infected macrophages to combat the invading bacteria.

Explanation:

The macrophages undergo autophagy to combat with the intracellular pathogens. The invading bacteria grow, survive and reproduce intracellularly in the organs like lungs affected by tuberculosis due to Mycobacterium tuberculosis invasion.

To combat these intracellular pathogens, the macrophage surrounds the microbes by creating a double walled membrane around them and creating the autophagosome. The suicidal bag of the cells – lysosomes engulf the autophagosome with the pathogen and will destroy it.  

6 0
3 years ago
Other questions:
  • Which organelle is responsible for making lipids and aiding in detoxification of cells?
    13·2 answers
  • Circle the letter of the region between the tropic of cancer and the tropic of Capricorn?
    11·1 answer
  • Enzymes are catalysts. This means that they are able to speed up chemical reactions. Which of the following statements is also t
    14·2 answers
  • suppose a person is sailing a ship saw breaking waves 1 kilometer offshore. Should the person sail the ship to the area or steer
    11·1 answer
  • Are bears consumers or producers
    12·2 answers
  • EASY BRAINLIEST
    6·2 answers
  • Name the two energy-equivalent molecules that contain three phosphates as part of their structure. what makes these two molecule
    8·1 answer
  • A point of view influenced by opinion is known as
    11·2 answers
  • The Moon can be seen on Earth because it produces its own light. True or false
    11·2 answers
  • Protein synthesis is accomplished primarily by the interaction of which two cells structures?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!