1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goblinko [34]
3 years ago
15

Write the code for RNA from this DNA STRAND : AAAAAATTTTTTCCCGGGGTTTATATATC

Biology
1 answer:
Cloud [144]3 years ago
4 0

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

You might be interested in
Most of Brazil has a warm climate due to which of the following? A.latitude B.elevation C.proximity D.air and water currents
Naddik [55]
The answer is <span>A.latitude</span>
3 0
4 years ago
Read 2 more answers
One of Mendel's Laws of Inheritance. This law states an organism has two different alleles for a trait and the allele that is ex
yarga [219]

Answer:

This is Law of Dominance.

Explanation:

  • On crossing pure bred pea plants  having one trait of a character with pure bred plants having a different trait of the same character , Mendel noticed that all the plants in the first filial generation were having only one trait though they received the factor for other trait.
  • However, when he allowed these plants of first filial generation to pollinate themselves, the other trait also appeared in some plants of second filial generation.
  • And thus the law of dominance was framed, which stated that, characters are controlled by discrete units called factors, these factors occur in pair and in a dissimilar pair of character one factor dominates and the other fails to appear.

         

4 0
3 years ago
Read 2 more answers
Which has more kinetic energy, a train traveling at 50 miles per hour, or a bicycle traveling at 15 miles per hour? Explain why.
padilas [110]

A train traveling at 50 miles per hour will have more kinetic energy than a bicycle traveling at 15 miles per hour

3 0
3 years ago
Read 2 more answers
Primary succession is most likely caused by 
Wittaler [7]
Volcanic eruption is the answer
8 0
4 years ago
Read 2 more answers
A channel protein specific for calcium ions was found to have a pore lined with six glutamate residues that participate in coord
Ganezh [65]

Answer:

If the mutation takes place, then the shorter side chains of asp compare to Glu  will affect the permeability of the transport protein to calcium ions. Specifically,  the mutation will  increase the sizes of the pore,which in turn decreases the selectivity  for calcium ion. Hence this affect excitability of the cell.

Explanation:

8 0
3 years ago
Other questions:
  • Pleeaseee heeelpppppp
    15·1 answer
  • What is it about the fatty tissues that makes them a good food source for the bears
    9·1 answer
  • What term is used to describe the relation of the clavicle to the breast?
    11·1 answer
  • Energy used by the body to perform muscular contractions is called adenosine diphosphate, or ADP.
    6·1 answer
  • What is a qualitative observation
    13·1 answer
  • Plants seemed to envovle in which order​
    9·1 answer
  • En Drosophila existe una mutación llamada Curly (Cy) que da lugar a que el ala se curve hacia arriba. Cuando se cruza un macho C
    9·1 answer
  • Help pls i need this right now
    10·1 answer
  • When the net filtration pressure is negative, what process is occurring?
    9·1 answer
  • What might happen to the rate of diffusion if the blood flow were to speed up?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!