1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis-greek [22]
3 years ago
10

What would happen to the human body if one of the organ systems stopped working

Biology
1 answer:
vodka [1.7K]3 years ago
8 0
It will most likely cause the human body system to stop functioning all together and leave you not feeling to good and it will be hard on your whole body while it makes a bad impact.
You might be interested in
What are two characteristics of DNA?
Lapatulllka [165]

Explanation:

DNA has three types of chemical component: phosphate, a sugar called deoxyribose, and four nitrogenous bases—adenine, guanine, cytosine, and thymine. Two of the bases, adenine and guanine, have a double-ring structure characteristic of a type of chemical called a purine.

6 0
2 years ago
How can a disease transition from a basic illness to a flown blown pandemic​
eimsori [14]

Answer:

Pandemics occur for two reasons. The first is a change in the infectious agent and the second is in human patterns. Both involve exposing people to agents they don’t have resistance to. Diseases like SARS, avian flu, and the famous Spanish flu all involved a mutation in the virus that resulted in a new disease that no one had resistance too. Examples of the second are when new groups of humans make contact, like small pox amongst native Americans, and possibly the black death.

Explanation:

3 0
2 years ago
Help pls it would be nice :p
timama [110]

see in<em> </em><em>the</em><em> </em><em>net</em><em> </em><em>ok</em><em> </em><em>na</em><em> </em>

<em>please </em><em>mark</em><em> </em><em>me</em><em> </em><em>as</em><em> </em><em>brainliest</em>

6 0
3 years ago
Read 2 more answers
Fatty acids that the body cannot produce are called _______
Mumz [18]
Essential fatty acids:)
6 0
2 years ago
Read 2 more answers
The ultimate goal of energy metabolism is to transform energy-yielding nutrients into what compound?.
coldgirl [10]

The ultimate goal of energy metabolism is produce the compound called ATP.

<h3>What is ATP?</h3>

This is known as Adenosine triphosphate and it is referred to as the energy currency of the cell.

It is formed during energy metabolism from energy-yielding nutrients such as carbohydrates etc which was why it was chosen as the most appropriate choice.

Read more about ATP here brainly.com/question/897553

4 0
2 years ago
Other questions:
  • What are two raw materials necessary for the process of photosynthesis?
    11·1 answer
  • _____ communicate with the body to ensure homeostasis
    12·2 answers
  • What are the cell structures that are needed for photosynthesis and the cell structures that are needed for cellular respiration
    8·1 answer
  • Newton's law of universal gravitation only refers to the
    12·1 answer
  • Which of these bases form a true complementary pair?
    7·2 answers
  • 43,200 scientific notation
    8·1 answer
  • What is the difference between an artery and a vein?
    9·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Use the drop-down menu to complete the sentence.
    10·1 answer
  • Can one model demonstrate all outcomes of mitosis?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!