Explanation:
hope it helps
plss mark me as brainliest
Hydrologists are most likely to perform actions relating to estimating the amount of groundwater in an aquifer.
<h3>Hydrologists</h3>
Hydrologists are scientists that specialize in the study of how water relates to the various crusts of the earth.
Hydrology in itself refers to the branch of science that studies how water moves relative to the earth's crusts.
Thus, species identification, age of fossils, or extracting underground oils have nothing to do with the work of hydrologists.
More on hydrology can be found here: brainly.com/question/13554728
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Since the sperm cells are haploid, the body cells are diploid. If the haploid cell is 4, double it would be 8.