1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mojhsa [17]
3 years ago
14

A red blood cell is placed into a sugar water solution. The red blood cell has a lower concentration of protein and sugar than t

he outside solution, as shown in the diagram. In the diagram, the volume of the cell is equal to the volume outside the cell. Protein and sugar are both too big to move through this cell's membrane.

Biology
2 answers:
Marat540 [252]3 years ago
7 0

Answer:

remember that it will go from areas of low, to areas of high concentration based on the gradient. So if the RBC has a lower amount of sugar and protein than the concentration outside of this cell, the cell will shrink due to the sugar and protein leaving.

I hope this is an answer you are looking for

ankoles [38]3 years ago
5 0

Becuase the cell has a lower concentration that the solution it is placed in, the solution is considered hypertonic. The cell will lose water through osmosis and will shrink, the 2nd option is correct.

You might be interested in
What are immortal cell lines and why are they important for cell research?
MAXImum [283]

Explanation:

hope it helps

plss mark me as brainliest

6 0
3 years ago
Read 2 more answers
Which of these tasks would a hydrologist be most likely to perform?
GuDViN [60]

Hydrologists are most likely to perform actions relating to estimating the amount of groundwater in an aquifer.

<h3>Hydrologists</h3>

Hydrologists are scientists that specialize in the study of how water relates to the various crusts of the earth.

Hydrology in itself refers to the branch of science that studies how water moves relative to the earth's crusts.

Thus, species identification, age of fossils, or extracting underground oils have nothing to do with the work of hydrologists.

More on hydrology can be found here: brainly.com/question/13554728

5 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
A male fruit fly has 4 chromosomes in each of its sperm cells how many chromosomes would be found in each of its regular body ce
s2008m [1.1K]
Since the sperm cells are haploid, the body cells are diploid. If the haploid cell is 4, double it would be 8.
4 0
3 years ago
This diagram shows the count of different species of snakes in a sample taken from an ecosystem.each shape represents a unique s
murzikaleks [220]

Answer: A

Explanation:

8 0
3 years ago
Other questions:
  • Many schools require applicants to take a test, such as the SAT or the ACT, as part of the admissions process. These tests deter
    15·2 answers
  • Which reaction best explains why carbon is able to from macromolecules ?
    8·1 answer
  • How does photosynthesis and cellular respiration work together?
    15·1 answer
  • Which of the following subject areas contains questions that can be answered by science?
    15·2 answers
  • What is the relationship between a gene and a allele
    12·1 answer
  • A bumblebee carries pollen from the male portion of a plant to the female portion of the same flower. fertilization occurs. whic
    9·2 answers
  • Aerobic exercise refers to physical activity that
    15·2 answers
  • Which phase occurs directly after s phase...<br> A. G1<br> B.G2<br> C. Cytokinesis<br> D.M phase
    14·1 answer
  • What does a sand shark look like?
    7·2 answers
  • What time period saw the biggest scientific advancements in the field of labor?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!