1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nika2105 [10]
3 years ago
13

65 g of sugar is dissolved in 750ml of water. What is the % concentration of the solution?

Biology
1 answer:
charle [14.2K]3 years ago
5 0

Answer:

answer 2000 mark as brain list

Explanation:

You might be interested in
The taking of a sediment to a new location is called?
hjlf
I believe your answer is erosion
8 0
3 years ago
Read 2 more answers
HELP ME PLEASE! The global climate is changing, and this change is apparent across many of Earth’s subsystems. Multiple sources
pychu [463]

Explanation:to control global warming we should control the green house gases which are the carbon dioxide formed by burning fossil fuels, methne formed by burning Agricultural fields, and also the nitrous oxide from nylon manufacturing.

So as a solution we should use technologies whichcan reduce smokes like by using solar and electric cars and recycling wastes instead of burning

3 0
3 years ago
Please help ASAP please it’s urgent
trapecia [35]

Answer:

I believe it's "chewed up food". I hope this helps.

5 0
3 years ago
Read 2 more answers
List the reasons why food chains to not send to exceed 4 links
Hitman42 [59]
As the number of organisms increase so does their tropic levels. As one organism eats the other energy is being transferred to that organism. The larger the food chain the lesser the organism' s would be because they would lose energy while trying to hunt and catch their prey and other activities. The food chain usually ends at the tertiary consumer or the fourth link because if it goes on like that there would be less energy hence these organisms would most likely starve and gradually die.
4 0
3 years ago
Which of the following statements is FALSE?
Delvig [45]

Answer:

c. Damage to the primary (somatic) motor cortex results in the loss of both voluntary muscle control and all reflexive contractions.

Explanation:

The primary motor cortex is an area in the brain that is responsible for the control and regulation of activities that involves movement of the body as well as the postures they body takes which we also refer to as motor skills.

The primary motor cortex sends signals in the form of nerve impulses to the brain and this in turn helps in the maintenance of the motor skills that is carried out by the body.

Not only does the damage to the primary (somatic) motor cortex results in the loss of both voluntary muscle control and all reflexive contractions, it also causes other losses such as constant contraction of the muscles also know as spasticity, involuntary muscle contraction also referred to as clonus.

5 0
4 years ago
Other questions:
  • Use the drop-down menus below to match the scientist(s) to their contribution to the discovery of base pairings. studied the rol
    10·2 answers
  • Why is it hard to build shelter on mars ?
    14·2 answers
  • After reviewing class material about the natural sources of drugs, the students demonstrate understanding of the material when t
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Name 3 ways we can protect and maintain stability within an aquatic ecosystem? please help
    12·2 answers
  • A scientist wants to know why the honeybee population is declining. Which step would the scientist MOST LIKELY do first?
    13·1 answer
  • In which layer of the Earth does the motion of the convection currents drive plate movement?
    15·2 answers
  • Where are most of the ATP molecules produced in aerobic respiration?
    13·1 answer
  • Label the brain parts please help me
    9·2 answers
  • Which of the following statements about prokaryotic cells is correct?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!