1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
exis [7]
3 years ago
15

Which is the correct order for the levels of organization in the human body?

Biology
1 answer:
pickupchik [31]3 years ago
5 0

Explanation:

B. cell,tissue, organ, organ system

hope it helps

You might be interested in
How to gain teens trust for medical reasons?
wolverine [178]
Become there friends and gain there trust by expressing your personal experiences
8 0
3 years ago
Which describes
iragen [17]

Answer:

B. Es la respuesta correcta.

Explanation:

pues heredar es cuando una persona le da unas caracteristricas de ella a otra y q se transmite generacion x generacion.

5 0
1 year ago
When neurons "fire," the first thing that happens is that sodium ions enter the cell. this does not require an input of energy.
Karo-lina-s [1.5K]

Answer;

One can infer that membrane transport proteins are required in order for neurons to fire.

Explanation;

Transport proteins are proteins that transport substances across biological membranes. Transport proteins are found within the membrane itself, where they form a channel, or a carrying mechanism, to allow their substrate to pass from one side to the other.

-Transport proteins transport materials such as; ions such as sodium and potassium; sugars such as glucose; proteins and messenger molecules; and many more. In neurons, they  play a fundamental role in the functioning of nerve cells. These transporters, a third class of membrane transport proteins, move a wide variety of ions and molecules across cell membranes.

5 0
3 years ago
How does the sexual life cycle of the human species introduce genetic
Lana71 [14]
All of the above- 1, 2, and 3 These introduce variation into the chromosome or into the zygote and create cells and offspring unique from the parents.
4 0
2 years ago
Angiosperms do not need water for fertilization. Why? (3 points) Group of answer choices Flagellated sperm travel to the ovary i
astraxan [27]

Answer:

A pollen tube grows from the pollen grain into the ovary

Explanation:

Water is needed for fertilization in several plant groups because the sperm needs to swim to meet the non-motile eggs of the female organs.

<em>However in angiosperms, the pollen germinates and a structure known as pollen tube which contains the male gametophyte (sperm) grows into the ovary where the ovule is located and the male gametophyte is deposited in the ovule to initiate the fertilization process.</em>

<em>Hence, water is really not necessary for fertilization in the angiosperms.</em>

5 0
3 years ago
Read 2 more answers
Other questions:
  • Somebody please help pleasseee i’m giving so much points
    13·1 answer
  • Plaese help me
    7·1 answer
  • A herpetologist wants to estimate how many snakes are in a forest. She counts 12 snakes in a 100,000 square foot area. Estimate
    8·1 answer
  • This element is a gas that is found in both nucleic acids and in amino acids, important building blocks of life. What is it? A.
    12·1 answer
  • Serves as a long-term storage area for water or nutrients.
    14·1 answer
  • What form of matter is made from only one type of atom
    12·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • During transformation,
    6·1 answer
  • The ecosystem we call the human body is also affected by abiotic components. List at least three abiotic components that could b
    11·1 answer
  • Define autotrophs and heterotrophs ​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!