1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allushta [10]
3 years ago
9

Name three organelles and how they support life within the cell

Biology
1 answer:
frozen [14]3 years ago
6 0
_RER: (rough endoplasmic reticulum)
it's role is to carry the ribosomes(subunits)
_mitochondrion: gives energy for the cell for its motility
_golgi body: responsible for maturation of the protein
You might be interested in
What do pathogens that cause cancer include?
Karo-lina-s [1.5K]

Answer:

Certain infectious agents, including viruses, bacteria, and parasites, can cause cancer or increase the risk that cancer will form. Some viruses can disrupt signaling that normally keeps cell growth and proliferation in check.

Explanation:

H. pylori is the first bacterium to be termed a definite cause of cancer in humans by the International Agency for Research on Cancer.

7 0
3 years ago
Pls help question is in picture
VikaD [51]

Answer: c. Adaptive Radiation

Explanation:

6 0
3 years ago
Read 2 more answers
Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i
Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

7 0
3 years ago
in the human nervous system, what is a synapse? A. The difference in ionic charge between the inside and outside of a neuron B.
LenaWriter [7]

Answer:

D

Explanation:

For more info, try specifically researching about synapse junctions

6 0
3 years ago
Plz help me well mark brainliest if you are correct!
astra-53 [7]

Answer:

C

Explanation:

Metamorphosis is the action of moths and butterflies changing into a different form.

By the way, can you follow me on Brainly?

Thanks!

8 0
3 years ago
Other questions:
  • Which condition is a cause of impotency in men ?
    15·2 answers
  • Why are mitochondria bigger in animal cells
    12·1 answer
  • In a pedigree, an open circle represents a
    15·1 answer
  • Unicellular organisms would most likely have _____.
    8·1 answer
  • What method can scientists use to determine the absolute age of a rock?
    12·2 answers
  • The four stages of cellular respiration do not function independently. Instead, they function ______
    8·1 answer
  • Oliver can't seem to learn all the types of animals living in a desert habitat. which type of memorization strategy might you re
    6·2 answers
  • The star 61 Cygni, in the constellation Cygnus, is a little more than 11 light-years from Earth. Which of the following correctl
    15·1 answer
  • 2. Imagine a population of crabs living on a white sandy beach. The crabs ONLY occur in two colors- red and blue, each controlle
    13·1 answer
  • How many mass in soft drinks crown in 1 pieces​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!