1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inna [77]
2 years ago
6

What type of reproduction involves forming offspring from one parent

Biology
1 answer:
AleksAgata [21]2 years ago
5 0

Answer:

Asexual reproduction

Explanation:

Process of creating new individual using one parent organism

You might be interested in
Discuss the connection between viruses and cancers, giving possible mechanisms for viruses that cause cancer.
Marrrta [24]
Cancers are said to be caused by genetics, meaning the disease originated from the DNA structure. There are viruses that affect the DNA. Examples are hepatitis B virus, Epstein-Barr virus, herpes virus-8 and human papilloma virus. These are the DNA viruses that could cause cancer.
6 0
3 years ago
The flexible nature of a cell membrane results from its...
Stells [14]
Channel proteins is the answer to your question
8 0
3 years ago
A DNA strand has mutated! What type of mutation has occured?
velikii [3]

Answer:

b

Explanation:

6 0
3 years ago
How is radar used to forecast weather?
docker41 [41]

Answer:

is used to locate and track severe storms, and follows the path of storm systems.

Explanation:

6 0
3 years ago
Read 2 more answers
How are limes grown?
Lady bird [3.3K]

Answer:off a tree

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • N
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What strategies should the radiologic technologist adopt to maintain good communication while approaching a child for radiograph
    8·2 answers
  • The Moon is 240,000 miles away from the Earth. What prediction can
    5·2 answers
  • Describe the structure of the<br> cell membrane and its components
    7·1 answer
  • When a sperm and egg cell combine, the new cell called a zygote contains:
    7·1 answer
  • Carbon dioxide moves through the plasma membrane through the process of
    14·1 answer
  • Geologists determine the
    13·1 answer
  • How do organs grow to the correct shape and size?
    12·2 answers
  • Please describe the process of natural selection in your own words by using an example.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!