1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
3 years ago
10

What are some of the patterns you noticed when looking at the maps in guided practice? Why do you think this might be?

Geography
2 answers:
Elina [12.6K]3 years ago
8 0

Answer:

can you add the photo of the graph please

irina1246 [14]3 years ago
8 0
You have to add a photo of the graph
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
A geographer that focuses on “human systems” will focus on the study of __________.
ella [17]

Answer:

B.

Explanation:

4 0
3 years ago
Read 2 more answers
A circle has a sector with area 20 π 20π20, pi and central angle of 2 5 π 5 2 ​ πstart color #9d38bd, start fraction, 2, divided
makkiz [27]
I have no clue but I’m only saying this rn so that I can ask for help bc I’m so mad abt it rn
7 0
3 years ago
An igneous rock has a coarse texture and is dark in color. How else can this rock be accurately described
Gnom [1K]

Answer:

by its crystal like appearence thus mostly forms near rocky areas

Explanation:

3 0
2 years ago
The mouth of a river empties into another body of water. true or false?
solmaris [256]
Pretty sure it's true
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following characteristic of magma does NOT determine the type of volcano?
    12·2 answers
  • You observe that an extra solar planet blocks 4% of its star light. knowing that the star's radius is 8x105 km, what is the radi
    7·1 answer
  • What are 3 facts about smelts
    9·1 answer
  • Why is it important to understand earth's different structures
    9·1 answer
  • What is a continuing source of tension between Syria and the United States?
    6·2 answers
  • In Gupta culture, most art, literature, music, and entertainment was based on
    12·2 answers
  • What are the disadvantages of hydroelectric energy?
    12·1 answer
  • PLEASE HURRY TIME IS RUNNING OUT
    10·1 answer
  • What is the cause of increasing desertification in Africa? What is causing the Sahara to increase in size
    11·1 answer
  • When the Earth, Sun, and Moon are in the positions shown above
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!