1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firlakuza [10]
3 years ago
5

I need help in class, I have one more to finish! Pls, help me, guys!

Biology
1 answer:
Ludmilka [50]3 years ago
8 0

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

You might be interested in
Select all that apply: Nucleic acids _____.
Marat540 [252]
I would believe the correct responses would be option 1,2,4.
5 0
3 years ago
Read 2 more answers
4). Which process can result in decreased biomass for a plant: cellular respiration or photosynthesis? Where does the mass/matte
zhuklara [117]
Cellular respiration results in decreased biomass for a plant. <span>In cellular respiration glucose and oxygen yield water and carbon dioxide. So, carbon dioxide is released in the into the air instead of forming organic molecules which could increase the biomass.</span>
8 0
3 years ago
What is a digestive system
Inga [223]
A digestive system is a part of the body that processes food into energy

4 0
4 years ago
Read 2 more answers
Which list shows three components of an organ system in order of least complex to most complex?
kolbaska11 [484]

Answer:

I believe its muscle cell, muscle tissue, stomach

Explanation:

The order for organ systems from least complex to most complex is: Cell, tissue, organ, organ system. Hope this helps

7 0
3 years ago
Read 2 more answers
How do sieve tubes elements group to make sieve tubes
kumpel [21]
<em>sieve tube elements are the cells of phloem which allow transportation of photosynthates through phloem...
<u>how sieve tube elements form sieve tubes:
</u>sieve tube elements are connected end to end and form a long chain which is called sieve tube,,,,
sieve tube elements are connected with the help of a side chain with the help of peptide bond...also one element has tapering end which easily overlaps with other end of next element to form sieve tube,,,,</em>

3 0
3 years ago
Other questions:
  • A cycad has
    12·1 answer
  • based on hierarchical organization, place the living systems in order from smallest to largest. blue wildebeest. blue wildebeest
    8·1 answer
  • Nervous tissue contains specialized cells called
    15·1 answer
  • What is the difference beween respiration and breathing​
    15·1 answer
  • Which stage of the cell cycle happens directly after cytokinesis?
    13·2 answers
  • Which type of organic molecule is made up of simple sugars that form long chains?
    8·1 answer
  • F.ree points 1×1=1 =1​
    6·2 answers
  • Ice has a higher __than liquid water
    13·1 answer
  • If you follow the scientific method, what happens after you make a hypothesis?
    6·1 answer
  • Which stains are used to visualize structures in the bacterial cell wall
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!