1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
8_murik_8 [283]
3 years ago
12

Does anyone know my teacher means by this please help

Biology
1 answer:
JulsSmile [24]3 years ago
7 0

Answer:

You must use a fume hood and lab it out

Explanation:

You might be interested in
Pls help me asap<br><br><br><br> ————————
harkovskaia [24]

Option B is the answer...........

8 0
3 years ago
Hey! I need your help! I’d greatly appreciate it! :)
vazorg [7]

Tropical Disturbance

Tropical Depression

Tropical Strom

Last but not least the tropical cyclone

7 0
3 years ago
Read 2 more answers
Which statement is true of this poem?
11111nata11111 [884]

Answer:

wrong subject but okay. The answer is (C). why?

Explanation:

Because the moon <u><em>IS</em></u> personified as an old man, the moon has been around for millions of years, therefore making the moon old, get it? Also post this on english or writing, not biology.

Hope you have a good day! Byeee <3333

6 0
3 years ago
Read 2 more answers
What do you think about growing up with polio would have been like?
aliya0001 [1]

Answer:

i think it would be cool!

Explanation:

6 0
3 years ago
A reactant in cellular respiration
Inga [223]

Answer:

Oxygen or Glucose

Explanation:

Oxygen and glucose are both reactents in cellular respiration.

7 0
3 years ago
Other questions:
  • Which of the following are not part of nonspecific defenses against infection?
    5·1 answer
  • A patient is taking bismuth subsalicylate [pepto-bismol] to prevent diarrhea. the nurse performing an assessment notes that the
    14·1 answer
  • What are analgesics antibiotics sedative and vaccines
    11·1 answer
  • The human genome project is dedicated to the sequencing of the human genetic code. Some people are opposed to sequencing the gen
    15·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • 49 POINTS!!!!!!!!!!!!!!!!!!!!!!
    13·2 answers
  • First one who answers this will be marked brainliest, thanked, and 5 stars will be given!!!
    14·1 answer
  • Phytoplankton, shown on the left in the image below, are microscopic organisms that can be found in freshwater and salt water en
    15·2 answers
  • What is a seismometer?
    11·2 answers
  • HELPPP PLEASEEEE
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!