1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natita [175]
3 years ago
15

A ship sonar detects an echo 1.6s after it sends the pluse.The speed of sound in water in 1500mls work out how deep the water is

Biology
1 answer:
yaroslaw [1]3 years ago
6 0

Answer:

1200m

Explanation:

Let the depth of sea be x.

Given that the sound has to travel to the bottom of the sea and get reflected back to the ship itself, thus total distance traveled by the sound is 2x.

Time taken to hear an echo t=1.6 s

Therefore, 2x = vt

Hence, we have 2x =1500m/s × 1.6s

=> 2x = 2400

⟹ x = 2400 ÷ 2

= 1200m

Hence, the final answer is 1200m

You might be interested in
What type of mutations will potentially be passed to offspring?
Harlamova29_29 [7]
Any kind of genetic DNA
3 0
3 years ago
Read 2 more answers
Which statement best describes a cause and its effect during the process or muscle contraction?​
Alisiya [41]

Answer. The most appropriate statement that is explaining the effect and cause during muscle contraction is. “The release of calcium ions causes myosin and actin to attach to each other.” The activation of muscles helps in the generation of muscles that send out the signals to the neurons.

hope this helps

7 0
2 years ago
A person who uses a computer at a desk does not have to worry about safety in the workplace. True or False
podryga [215]

False, you could get hurt by electric shock if you spill coffee or another beverage

8 0
3 years ago
Read 2 more answers
Why does DNA need to replicate before cells divide?
gizmo_the_mogwai [7]
DNA needs to replicate before cells divide to give the complete set of genetic instructions to its daughter cells, (or ensures that each new cell inherits all of the genetic traits of the parent cell). 

Hope this helps! :D

~PutarPotato 
5 0
2 years ago
Sinh sản ancistrustemminckii
Vlada [557]

ANSWER :

Ancistrus is a genus of nocturnal freshwater fish in the family Loricariidae of order Siluriformes, ... Historically, commonly available species of Ancistrus were Ancistrus cirrhosus and Ancistrus temminckii; other species are now available, though .

Explanation:

Hope it helps

4 0
3 years ago
Other questions:
  • Which cells allow the body to sense touch? A. melanocytes B. keratinocytes C. dendritic cells D. tactile cells​
    13·1 answer
  • This type of succession occurs after a forest fire
    12·1 answer
  • DNA and ran are made up of what​
    15·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Differentiate between a cloth safety belt and a metal buckle in terms of thermal conductors and insulators.
    10·2 answers
  • An atom of argon has three electron shells, all of
    11·1 answer
  • Which of the following is rich in organic nutrients? 
    11·1 answer
  • Can someone please please please help me
    10·1 answer
  • How would you describe the interior of the lungs?​
    14·2 answers
  • 21.__________can be caused by a variety of alterations in DNA. Give some examples.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!